ID: 973381227

View in Genome Browser
Species Human (GRCh38)
Location 4:49322220-49322242
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973381227_973381239 7 Left 973381227 4:49322220-49322242 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973381239 4:49322250-49322272 CCCAGAAACTCAGACCCAAGGGG No data
973381227_973381236 5 Left 973381227 4:49322220-49322242 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973381236 4:49322248-49322270 CTCCCAGAAACTCAGACCCAAGG No data
973381227_973381243 22 Left 973381227 4:49322220-49322242 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973381243 4:49322265-49322287 CCAAGGGGCAGCTCCTCACCAGG No data
973381227_973381237 6 Left 973381227 4:49322220-49322242 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973381237 4:49322249-49322271 TCCCAGAAACTCAGACCCAAGGG No data
973381227_973381245 29 Left 973381227 4:49322220-49322242 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973381245 4:49322272-49322294 GCAGCTCCTCACCAGGGATGTGG No data
973381227_973381244 23 Left 973381227 4:49322220-49322242 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973381244 4:49322266-49322288 CAAGGGGCAGCTCCTCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973381227 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr