ID: 973382312

View in Genome Browser
Species Human (GRCh38)
Location 4:49329265-49329287
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973382312_973382330 29 Left 973382312 4:49329265-49329287 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973382330 4:49329317-49329339 GCAGCTCCTCACCAGGGATGTGG No data
973382312_973382328 22 Left 973382312 4:49329265-49329287 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973382328 4:49329310-49329332 CCAAGGGGCAGCTCCTCACCAGG No data
973382312_973382322 6 Left 973382312 4:49329265-49329287 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973382322 4:49329294-49329316 TCCCAGAAACTCAGACCCAAGGG No data
973382312_973382329 23 Left 973382312 4:49329265-49329287 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973382329 4:49329311-49329333 CAAGGGGCAGCTCCTCACCAGGG No data
973382312_973382324 7 Left 973382312 4:49329265-49329287 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973382324 4:49329295-49329317 CCCAGAAACTCAGACCCAAGGGG No data
973382312_973382321 5 Left 973382312 4:49329265-49329287 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973382321 4:49329293-49329315 CTCCCAGAAACTCAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973382312 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr