ID: 973382645 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:49331098-49331120 |
| Sequence | GTGTGCCAGTAGCAAGTAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973382645_973382648 | 7 | Left | 973382645 | 4:49331098-49331120 | CCATCTACTTGCTACTGGCACAC | No data | ||
| Right | 973382648 | 4:49331128-49331150 | AGCAGAAGAGGCCCCTGTCATGG | No data | ||||
| 973382645_973382646 | -5 | Left | 973382645 | 4:49331098-49331120 | CCATCTACTTGCTACTGGCACAC | No data | ||
| Right | 973382646 | 4:49331116-49331138 | CACACTCTTGCCAGCAGAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973382645 | Original CRISPR | GTGTGCCAGTAGCAAGTAGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||