ID: 973382645

View in Genome Browser
Species Human (GRCh38)
Location 4:49331098-49331120
Sequence GTGTGCCAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973382645_973382648 7 Left 973382645 4:49331098-49331120 CCATCTACTTGCTACTGGCACAC No data
Right 973382648 4:49331128-49331150 AGCAGAAGAGGCCCCTGTCATGG No data
973382645_973382646 -5 Left 973382645 4:49331098-49331120 CCATCTACTTGCTACTGGCACAC No data
Right 973382646 4:49331116-49331138 CACACTCTTGCCAGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973382645 Original CRISPR GTGTGCCAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr