ID: 973385851

View in Genome Browser
Species Human (GRCh38)
Location 4:49513877-49513899
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973385851_973385862 7 Left 973385851 4:49513877-49513899 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973385862 4:49513907-49513929 CCCAGAAACTCAGACCCAACGGG No data
973385851_973385868 29 Left 973385851 4:49513877-49513899 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973385868 4:49513929-49513951 GCAGCTCCTCACCAGGGATGTGG No data
973385851_973385866 22 Left 973385851 4:49513877-49513899 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973385866 4:49513922-49513944 CCAACGGGCAGCTCCTCACCAGG No data
973385851_973385867 23 Left 973385851 4:49513877-49513899 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973385867 4:49513923-49513945 CAACGGGCAGCTCCTCACCAGGG No data
973385851_973385860 6 Left 973385851 4:49513877-49513899 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973385860 4:49513906-49513928 TCCCAGAAACTCAGACCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973385851 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr