ID: 973386255 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:49516147-49516169 |
| Sequence | GTGTGACAGTAGCAAGTAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973386255_973386256 | -5 | Left | 973386255 | 4:49516147-49516169 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 973386256 | 4:49516165-49516187 | CACACTCTTGCCAGCAGAAGAGG | No data | ||||
| 973386255_973386258 | 7 | Left | 973386255 | 4:49516147-49516169 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 973386258 | 4:49516177-49516199 | AGCAGAAGAGGCCCCTGTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973386255 | Original CRISPR | GTGTGACAGTAGCAAGTAGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||