ID: 973386255

View in Genome Browser
Species Human (GRCh38)
Location 4:49516147-49516169
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973386255_973386256 -5 Left 973386255 4:49516147-49516169 CCATCTACTTGCTACTGTCACAC No data
Right 973386256 4:49516165-49516187 CACACTCTTGCCAGCAGAAGAGG No data
973386255_973386258 7 Left 973386255 4:49516147-49516169 CCATCTACTTGCTACTGTCACAC No data
Right 973386258 4:49516177-49516199 AGCAGAAGAGGCCCCTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973386255 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr