ID: 973386873

View in Genome Browser
Species Human (GRCh38)
Location 4:49518981-49519003
Sequence GCACTGGGACCCAGGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973386873_973386882 9 Left 973386873 4:49518981-49519003 CCAGGGTCCCTGGGTCCCAGTGC No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data
973386873_973386883 10 Left 973386873 4:49518981-49519003 CCAGGGTCCCTGGGTCCCAGTGC No data
Right 973386883 4:49519014-49519036 GGGAAGACACTTTCGTCTGTGGG No data
973386873_973386885 19 Left 973386873 4:49518981-49519003 CCAGGGTCCCTGGGTCCCAGTGC No data
Right 973386885 4:49519023-49519045 CTTTCGTCTGTGGGGCACCCAGG No data
973386873_973386884 11 Left 973386873 4:49518981-49519003 CCAGGGTCCCTGGGTCCCAGTGC No data
Right 973386884 4:49519015-49519037 GGAAGACACTTTCGTCTGTGGGG No data
973386873_973386879 -10 Left 973386873 4:49518981-49519003 CCAGGGTCCCTGGGTCCCAGTGC No data
Right 973386879 4:49518994-49519016 GTCCCAGTGCAGGGACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973386873 Original CRISPR GCACTGGGACCCAGGGACCC TGG (reversed) Intergenic
No off target data available for this crispr