ID: 973386876

View in Genome Browser
Species Human (GRCh38)
Location 4:49518988-49519010
Sequence AGTCCCTGCACTGGGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973386876_973386882 2 Left 973386876 4:49518988-49519010 CCCTGGGTCCCAGTGCAGGGACT No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data
973386876_973386886 28 Left 973386876 4:49518988-49519010 CCCTGGGTCCCAGTGCAGGGACT No data
Right 973386886 4:49519039-49519061 ACCCAGGCCGTGTTTCTCCGCGG No data
973386876_973386885 12 Left 973386876 4:49518988-49519010 CCCTGGGTCCCAGTGCAGGGACT No data
Right 973386885 4:49519023-49519045 CTTTCGTCTGTGGGGCACCCAGG No data
973386876_973386884 4 Left 973386876 4:49518988-49519010 CCCTGGGTCCCAGTGCAGGGACT No data
Right 973386884 4:49519015-49519037 GGAAGACACTTTCGTCTGTGGGG No data
973386876_973386883 3 Left 973386876 4:49518988-49519010 CCCTGGGTCCCAGTGCAGGGACT No data
Right 973386883 4:49519014-49519036 GGGAAGACACTTTCGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973386876 Original CRISPR AGTCCCTGCACTGGGACCCA GGG (reversed) Intergenic
No off target data available for this crispr