ID: 973386882

View in Genome Browser
Species Human (GRCh38)
Location 4:49519013-49519035
Sequence TGGGAAGACACTTTCGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973386873_973386882 9 Left 973386873 4:49518981-49519003 CCAGGGTCCCTGGGTCCCAGTGC No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data
973386880_973386882 -6 Left 973386880 4:49518996-49519018 CCCAGTGCAGGGACTGATGGGAA No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data
973386881_973386882 -7 Left 973386881 4:49518997-49519019 CCAGTGCAGGGACTGATGGGAAG No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data
973386868_973386882 30 Left 973386868 4:49518960-49518982 CCTGAGCTCGAACGAGGGACACC No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data
973386876_973386882 2 Left 973386876 4:49518988-49519010 CCCTGGGTCCCAGTGCAGGGACT No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data
973386877_973386882 1 Left 973386877 4:49518989-49519011 CCTGGGTCCCAGTGCAGGGACTG No data
Right 973386882 4:49519013-49519035 TGGGAAGACACTTTCGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973386882 Original CRISPR TGGGAAGACACTTTCGTCTG TGG Intergenic
No off target data available for this crispr