ID: 973386886

View in Genome Browser
Species Human (GRCh38)
Location 4:49519039-49519061
Sequence ACCCAGGCCGTGTTTCTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973386880_973386886 20 Left 973386880 4:49518996-49519018 CCCAGTGCAGGGACTGATGGGAA No data
Right 973386886 4:49519039-49519061 ACCCAGGCCGTGTTTCTCCGCGG No data
973386881_973386886 19 Left 973386881 4:49518997-49519019 CCAGTGCAGGGACTGATGGGAAG No data
Right 973386886 4:49519039-49519061 ACCCAGGCCGTGTTTCTCCGCGG No data
973386876_973386886 28 Left 973386876 4:49518988-49519010 CCCTGGGTCCCAGTGCAGGGACT No data
Right 973386886 4:49519039-49519061 ACCCAGGCCGTGTTTCTCCGCGG No data
973386877_973386886 27 Left 973386877 4:49518989-49519011 CCTGGGTCCCAGTGCAGGGACTG No data
Right 973386886 4:49519039-49519061 ACCCAGGCCGTGTTTCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973386886 Original CRISPR ACCCAGGCCGTGTTTCTCCG CGG Intergenic
No off target data available for this crispr