ID: 973387661

View in Genome Browser
Species Human (GRCh38)
Location 4:49524275-49524297
Sequence TGCCAGACCCTGCCCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973387661_973387669 14 Left 973387661 4:49524275-49524297 CCAGGCCGGGGCAGGGTCTGGCA No data
Right 973387669 4:49524312-49524334 GGGCACCCGCGATCCAGAGGCGG No data
973387661_973387672 20 Left 973387661 4:49524275-49524297 CCAGGCCGGGGCAGGGTCTGGCA No data
Right 973387672 4:49524318-49524340 CCGCGATCCAGAGGCGGCCCAGG No data
973387661_973387666 -6 Left 973387661 4:49524275-49524297 CCAGGCCGGGGCAGGGTCTGGCA No data
Right 973387666 4:49524292-49524314 CTGGCAGTCTCTCAGGCCAGGGG No data
973387661_973387664 -8 Left 973387661 4:49524275-49524297 CCAGGCCGGGGCAGGGTCTGGCA No data
Right 973387664 4:49524290-49524312 GTCTGGCAGTCTCTCAGGCCAGG No data
973387661_973387668 11 Left 973387661 4:49524275-49524297 CCAGGCCGGGGCAGGGTCTGGCA No data
Right 973387668 4:49524309-49524331 CAGGGGCACCCGCGATCCAGAGG No data
973387661_973387665 -7 Left 973387661 4:49524275-49524297 CCAGGCCGGGGCAGGGTCTGGCA No data
Right 973387665 4:49524291-49524313 TCTGGCAGTCTCTCAGGCCAGGG No data
973387661_973387673 21 Left 973387661 4:49524275-49524297 CCAGGCCGGGGCAGGGTCTGGCA No data
Right 973387673 4:49524319-49524341 CGCGATCCAGAGGCGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973387661 Original CRISPR TGCCAGACCCTGCCCCGGCC TGG (reversed) Intergenic
No off target data available for this crispr