ID: 973391373

View in Genome Browser
Species Human (GRCh38)
Location 4:49560264-49560286
Sequence CACCCAGGACAACCCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973391364_973391373 9 Left 973391364 4:49560232-49560254 CCATTCTGCATTTTTCTCATCAC No data
Right 973391373 4:49560264-49560286 CACCCAGGACAACCCCATCAGGG No data
973391363_973391373 22 Left 973391363 4:49560219-49560241 CCTCACAGCAATTCCATTCTGCA No data
Right 973391373 4:49560264-49560286 CACCCAGGACAACCCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973391373 Original CRISPR CACCCAGGACAACCCCATCA GGG Intergenic
No off target data available for this crispr