ID: 973532167

View in Genome Browser
Species Human (GRCh38)
Location 4:51844377-51844399
Sequence CTCGCTTCCCGCCGTCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 61}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973532167_973532179 13 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532179 4:51844413-51844435 CGGGCTCCGGCAGCGGGACTAGG 0: 1
1: 0
2: 1
3: 12
4: 131
973532167_973532185 25 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532185 4:51844425-51844447 GCGGGACTAGGAGGCGGGGCAGG 0: 1
1: 0
2: 4
3: 51
4: 471
973532167_973532177 6 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532177 4:51844406-51844428 GCTGGCGCGGGCTCCGGCAGCGG 0: 1
1: 0
2: 4
3: 30
4: 249
973532167_973532178 7 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532178 4:51844407-51844429 CTGGCGCGGGCTCCGGCAGCGGG 0: 1
1: 0
2: 1
3: 16
4: 230
973532167_973532186 26 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532186 4:51844426-51844448 CGGGACTAGGAGGCGGGGCAGGG 0: 1
1: 0
2: 4
3: 30
4: 310
973532167_973532182 19 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532182 4:51844419-51844441 CCGGCAGCGGGACTAGGAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 177
973532167_973532183 20 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532183 4:51844420-51844442 CGGCAGCGGGACTAGGAGGCGGG No data
973532167_973532175 -6 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532175 4:51844394-51844416 AGCGAGGTCAGCGCTGGCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 144
973532167_973532176 0 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532176 4:51844400-51844422 GTCAGCGCTGGCGCGGGCTCCGG No data
973532167_973532180 16 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532180 4:51844416-51844438 GCTCCGGCAGCGGGACTAGGAGG No data
973532167_973532174 -7 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532174 4:51844393-51844415 AAGCGAGGTCAGCGCTGGCGCGG No data
973532167_973532184 21 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532184 4:51844421-51844443 GGCAGCGGGACTAGGAGGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 235
973532167_973532187 27 Left 973532167 4:51844377-51844399 CCCCCCGGACGGCGGGAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 973532187 4:51844427-51844449 GGGACTAGGAGGCGGGGCAGGGG 0: 1
1: 0
2: 4
3: 71
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973532167 Original CRISPR CTCGCTTCCCGCCGTCCGGG GGG (reversed) Intronic
900147475 1:1164731-1164753 CTCGGCTCCCGCGGTCGGGGAGG + Intergenic
900760742 1:4468507-4468529 TTCACTTCCCGCAGTCCTGGAGG - Intergenic
901066694 1:6497588-6497610 CCCGGTGCCCGCCCTCCGGGAGG - Intronic
901228464 1:7628785-7628807 CTGGCTTCCAGCCATCCAGGAGG + Intronic
903309417 1:22442622-22442644 CTTGCTTACAGCCCTCCGGGTGG - Intergenic
903614772 1:24643613-24643635 CTCGCTGCCCGCCTGCCTGGCGG + Intronic
922440744 1:225653290-225653312 CTCGCTCTCCGCAGTCCGGCGGG - Intergenic
1074801563 10:117005450-117005472 CTCGCGTCCCTGAGTCCGGGAGG - Exonic
1077373748 11:2195608-2195630 CCCGCTTCCCGCCCCCGGGGAGG + Intergenic
1081574160 11:44309113-44309135 CTCGCTCCTCGCCGGCTGGGAGG - Intronic
1081860914 11:46332984-46333006 CTCCGCTCCAGCCGTCCGGGGGG + Intronic
1084489582 11:69471148-69471170 CTCGCCGCCCGTCGTCCAGGCGG + Intergenic
1110891595 13:80704538-80704560 CTCAGTTCCCGCCTTGCGGGCGG - Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1119711557 14:76826270-76826292 CAGGCTTCCCGCCCTCTGGGTGG - Intergenic
1132055971 15:98650162-98650184 CTCGCACCCCGCGGGCCGGGCGG - Intronic
1142909180 17:3072485-3072507 CTTCCTTCCCGCCTTCTGGGTGG + Intergenic
1142925381 17:3231753-3231775 CTTCCTTCCCGCCTTCTGGGTGG - Intergenic
1143174266 17:4947646-4947668 CTCCCTTCCCGCCATCCGGCGGG - Intronic
1145935196 17:28711183-28711205 CTCCCGCCCCGGCGTCCGGGTGG + Intronic
1148989009 17:51649110-51649132 CTGGCTTCCCGCCTTCAGGCAGG + Intronic
1150335484 17:64327516-64327538 CTCGCCTCCCCCCTTCCTGGAGG - Intronic
1151612158 17:75183114-75183136 GCCTCTTCCCGCCGGCCGGGCGG - Intergenic
1155343450 18:24835957-24835979 CTGGCTTCCTGCCTTCAGGGAGG + Intergenic
1160528368 18:79549951-79549973 CTGCCTTCCCGCCGTCCGCACGG - Intergenic
1160528695 18:79551443-79551465 CTGCCTTCCCGCCGTCCGCACGG - Intergenic
1160528788 18:79551875-79551897 CTGCCTTCCCGCCGTCCGCACGG - Intergenic
1160528800 18:79551929-79551951 CTGCCTTCCCGCCGTCCGCACGG - Intergenic
1163485076 19:17580651-17580673 CTCTCCTCCCGCCCTCCGGAGGG - Intronic
1166367407 19:42284483-42284505 CCTGCCTCCCGCCGCCCGGGGGG - Intronic
1167473853 19:49689311-49689333 CTCGCTCCACGCCCTCCAGGGGG + Exonic
934761757 2:96860594-96860616 CACGCTTCCCGCCGACGCGGTGG + Exonic
937876266 2:126827680-126827702 CTGGCTTCCCGCAGCCCTGGAGG + Intergenic
947591493 2:231388613-231388635 CTCACATCCCGCCCACCGGGCGG - Intergenic
1170400523 20:15978335-15978357 CTTGCTTACAGCCCTCCGGGTGG + Intronic
1172539354 20:35699164-35699186 CTCGGGTCCCGCTCTCCGGGAGG - Intronic
1176161322 20:63650435-63650457 CACCCCTCCCGCCGTCCAGGTGG + Intronic
1176161341 20:63650491-63650513 CACCCCTCCCGCCGTCCAGGTGG + Intronic
1176161438 20:63650761-63650783 CACCCCTCCCGCCGTCCAGGTGG + Intronic
1179984126 21:44911843-44911865 TTCCCTTCCCTCCATCCGGGAGG + Intronic
1183437502 22:37804328-37804350 CTCGCTGCCCCCCATCCGTGAGG - Intergenic
1184853858 22:47136081-47136103 CTCACTTCCCTCCGTACGTGAGG - Intronic
1185138991 22:49089715-49089737 CTCTCTTCCCGCCCTCCAGACGG - Intergenic
950043222 3:9933436-9933458 CTCGCGCCCCGCGTTCCGGGCGG + Exonic
960281304 3:115784230-115784252 CTAGCTTCCTCCCGACCGGGCGG + Intergenic
968293200 3:197554958-197554980 CTCTCTCCCCGCCCTCCGGCCGG - Intronic
969559864 4:7939935-7939957 CTCGCTTCCCATTGGCCGGGGGG - Exonic
973532167 4:51844377-51844399 CTCGCTTCCCGCCGTCCGGGGGG - Intronic
976758455 4:88523443-88523465 CTCCCTTTCCGCCCACCGGGAGG + Intronic
985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG + Exonic
985727564 5:1524033-1524055 CTCGCCTCCCGCCGGCCGGCAGG + Intergenic
989229834 5:39073957-39073979 CTCGGTTCCCGCGGGCCGGCAGG + Intronic
998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG + Intergenic
999272830 5:150307563-150307585 CTCGCTTCCAGACCTCTGGGTGG + Intronic
1002190061 5:177473339-177473361 CTCCCTTCCCGGCGGCGGGGCGG + Intronic
1006472189 6:34235537-34235559 AGCGCTTCCCGCCGCACGGGTGG + Intergenic
1016393672 6:143600093-143600115 CAGGCTGCCCGCCGTCCGGCCGG + Intronic
1032274265 7:130440821-130440843 GCCCCTTCCCGCCTTCCGGGCGG + Intronic
1035717436 8:1764392-1764414 CTCGCTTCCCTCAGACCGGCTGG + Intronic
1039566307 8:38554651-38554673 ATCGCTTCCCGCCGGTGGGGAGG + Intergenic
1050513033 9:6413949-6413971 CTCGCTTCCCGCGCTCGGCGGGG + Intronic
1060812034 9:126615393-126615415 CCCGCATCCCGCCGTCTGCGAGG + Exonic
1061445670 9:130635890-130635912 CTGCCTTCCAGCCGTCCGGAGGG + Intronic
1062007828 9:134250300-134250322 CTCGTTTCCCGCAGTCCTGGAGG - Intergenic
1195884512 X:109625067-109625089 CTCGCTTCCCCTCGCCCAGGGGG - Exonic
1197215017 X:123859747-123859769 CTCGGTTCCAGCCGGGCGGGGGG + Intronic