ID: 973533888

View in Genome Browser
Species Human (GRCh38)
Location 4:51861386-51861408
Sequence GGCCCAGCTCACCGAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973533888 Original CRISPR GGCCCAGCTCACCGAAGTCC TGG Intronic
901435598 1:9245584-9245606 CGCCCAGCTCACCCTAGCCCTGG - Intronic
901801246 1:11709315-11709337 GGCAGAGCTCTCCGAAGCCCAGG + Exonic
903071100 1:20727328-20727350 GGCCCAGGTCACAGTAGCCCAGG + Intronic
904383652 1:30127800-30127822 GGCCCAGCTCACAGGAGGCCAGG - Intergenic
904613243 1:31736561-31736583 GGCCCTGCTCACCCCAGCCCAGG + Exonic
905823962 1:41015509-41015531 GGCCCAGCCCACCTCTGTCCAGG - Intergenic
906416162 1:45622612-45622634 GGCCCAGCACGCCGGGGTCCCGG + Exonic
907400720 1:54223308-54223330 GGCCCAGCTCCCCTCAGTTCAGG + Intronic
912283070 1:108338235-108338257 GGCTCAACTGACTGAAGTCCAGG + Intergenic
914243094 1:145865678-145865700 GTCCCAGCTCCCCAAAGTGCTGG - Intergenic
915221729 1:154380056-154380078 TGCCCAGCTCCCCACAGTCCGGG - Intergenic
920401575 1:205679873-205679895 GTCCCGGCTCCCCCAAGTCCCGG + Intronic
921071403 1:211661105-211661127 CGCCCAGCTCAAGGAGGTCCTGG - Intronic
921947187 1:220894301-220894323 GGCGCAGCTCTCCGAGGTCAGGG - Intergenic
924439416 1:244074003-244074025 GGCCCAGATCCCCTAGGTCCTGG - Intergenic
1062825650 10:566613-566635 GCCCCAGCACACAGAAGCCCAGG + Intronic
1064536810 10:16365819-16365841 GCCTCAGCTCCCCAAAGTCCTGG + Intergenic
1064759243 10:18601731-18601753 GCCTCAGCTTCCCGAAGTCCTGG - Intronic
1067019635 10:42783252-42783274 CGCCCAGCTCTCCTAACTCCTGG + Intronic
1067227793 10:44386665-44386687 GGCCCAGCCCAGCAAAGGCCTGG - Intergenic
1067499306 10:46787285-46787307 TGCCCAGCTCTCCTAACTCCCGG + Intergenic
1067595323 10:47553039-47553061 TGCCCAGCTCTCCTAACTCCCGG - Intergenic
1068955856 10:62818207-62818229 GGCCCAGCGCACCGCGGTCAGGG + Intronic
1070139686 10:73730026-73730048 TGCCCAGCTCTCCTAACTCCCGG - Intergenic
1070778445 10:79123834-79123856 AGCCCAGCTCACAGCAGGCCTGG + Intronic
1070886647 10:79905459-79905481 TGCCCAGCTCTCCTAACTCCCGG + Intergenic
1071376605 10:85012114-85012136 GGCCCAGGTCACCCAAGTGTGGG - Intergenic
1072575357 10:96694598-96694620 GTCCTAGCTCACTGAAGTCTTGG + Intronic
1073101091 10:101007090-101007112 GGCCCAGGTCAGCGAGCTCCCGG - Exonic
1073206267 10:101770955-101770977 GGGCCAGGGAACCGAAGTCCTGG - Intronic
1074477225 10:113784367-113784389 GGCCCAGAACACAGAACTCCTGG + Intergenic
1075090818 10:119443471-119443493 GGCGCTGCTCACAGAAGGCCTGG - Intronic
1075615582 10:123888925-123888947 TGCCCAGTTCACCGCAGCCCTGG - Intronic
1075629947 10:123994824-123994846 GGACCAGCTCACTGGAGACCAGG - Intergenic
1076409016 10:130232706-130232728 GGCCCAGCCCAGGGCAGTCCAGG + Intergenic
1077232560 11:1464571-1464593 GGCCCTGCACACAGCAGTCCAGG + Intergenic
1081607903 11:44538599-44538621 GGCCCTGCTCACTGCTGTCCAGG - Intergenic
1084289455 11:68152490-68152512 AGCTCAGCTCTCCGAAGTCGAGG + Intergenic
1087483683 11:98733969-98733991 GACCCAGCTCACCTGAGTGCAGG - Intergenic
1089607352 11:119649048-119649070 GGCCCAGCTCCCAGATGCCCAGG - Intronic
1097279580 12:57836408-57836430 GGCCCAGCTTCCCAAAGTGCTGG - Intronic
1097382607 12:58913018-58913040 GGCCCAGGTCAGCTAAGTCACGG - Intronic
1098356491 12:69617358-69617380 GGAGCAGCTCACCGAACTCAGGG - Intergenic
1100471000 12:94892831-94892853 ACCACAGCCCACCGAAGTCCTGG - Intergenic
1102305306 12:111800144-111800166 AGCCCAGCTCCCCAAATTCCAGG - Intronic
1107606266 13:42060383-42060405 GGCCCAGATCTCAGAAGTACAGG - Intronic
1119390715 14:74289471-74289493 GGACCAGCTCACCTGAGTCGGGG + Exonic
1121069415 14:91003981-91004003 AGCCCAGCTCACCAAGGTCAAGG + Intronic
1121436456 14:93923714-93923736 GGCCCAGCTTATCCAAGTTCAGG + Intronic
1122262301 14:100530527-100530549 GGCCCAGCTGGCCACAGTCCTGG - Intergenic
1122290491 14:100678142-100678164 GGCCCAGCTCCCCTAAGCCATGG + Intergenic
1123056266 14:105572121-105572143 GGCCCAGGTCTCCGAGGCCCAGG - Intergenic
1123057667 14:105579686-105579708 GGCCCAGGTCTCCGAGGCCCAGG + Intergenic
1123080695 14:105692249-105692271 GGCCCAGGTCTCCGAGGCCCAGG - Intergenic
1123081946 14:105699619-105699641 GGCCCAGGTCTCCGAGGCCCAGG + Intergenic
1129912635 15:79241034-79241056 GGCCCAGCTCACCCTAGCACTGG - Intergenic
1131255746 15:90860843-90860865 GGCCCCTCTCCCTGAAGTCCTGG - Intergenic
1131934870 15:97492211-97492233 AGCCCAGCTCTCCTAACTCCAGG + Intergenic
1132736684 16:1389507-1389529 GTCCCAGCTCACTGCAGCCCGGG - Intronic
1134799852 16:17073541-17073563 GCCCCAGCTCACCGAGCTCATGG - Intergenic
1137440979 16:48498305-48498327 GGCCCAGCTGGCTGGAGTCCGGG + Intergenic
1137986445 16:53112396-53112418 AGCTCAGCTCAGCCAAGTCCAGG - Intronic
1141039938 16:80664407-80664429 GGCCCAGGACACCGGAGCCCTGG - Intronic
1141676773 16:85521942-85521964 GGCCCCGCTCACAGAAGCCAGGG + Intergenic
1141879802 16:86850286-86850308 GGCCCTAATCACCCAAGTCCTGG - Intergenic
1142365397 16:89647295-89647317 GGCCCAGGTGACCAAAGCCCTGG - Exonic
1143338348 17:6190326-6190348 GGCCCACCTCAGGGCAGTCCAGG - Intergenic
1147555700 17:41477627-41477649 GGCCCAGCTGGCCGAGATCCGGG - Exonic
1147561094 17:41509676-41509698 GGCCCAGAATACTGAAGTCCAGG + Intergenic
1148347363 17:46912380-46912402 GGTCCAGCTCCCCGATGACCTGG + Intergenic
1152090192 17:78242235-78242257 GGCCCAGCTCCGCCAGGTCCTGG + Intergenic
1152719015 17:81913722-81913744 GGCCCAGCACACAGAGGTGCGGG + Intronic
1152851251 17:82637641-82637663 GGCACGGCTCACCGAACTCAGGG + Intronic
1159626586 18:70702240-70702262 GGCTTAGCTCACCAACGTCCGGG + Intergenic
1160629290 18:80234174-80234196 GCCCCAGCACAGCGATGTCCTGG + Intronic
1160935326 19:1592100-1592122 AGCCCTGCTCCCCGAAATCCCGG + Intronic
1161572621 19:5038760-5038782 GGCCCAGCGCACCCATCTCCTGG - Intronic
1162369696 19:10271252-10271274 GGGCCAGTTCTCCGAAGCCCCGG + Intronic
1163442498 19:17328884-17328906 GGCCCAGCTCGCCGCGGCCCAGG + Exonic
1164478967 19:28597021-28597043 GGCCCAGCTCTCAGAAGAGCAGG + Intergenic
1164630676 19:29759670-29759692 AGCCCTCCCCACCGAAGTCCCGG - Intergenic
1165070258 19:33251449-33251471 GCCCCACCTCACTGATGTCCTGG + Intergenic
1165183171 19:33990350-33990372 GGCACAGCTCACAGAAGTTGGGG + Intergenic
1166659306 19:44635651-44635673 TGCCCAGCTCATCAAATTCCTGG + Intronic
1167598707 19:50441083-50441105 GGCCCAGCTCCCCCCAGACCAGG - Intronic
1168092838 19:54096877-54096899 GTCCCAGCCCAGCGATGTCCTGG - Exonic
926012471 2:9419703-9419725 TGCACAGCTCACAGAACTCCCGG + Intronic
926134509 2:10326888-10326910 GGCCCAGCTCAGCCAAATCTAGG - Intronic
928180447 2:29064955-29064977 GGCCCAGCACACAGAACTCTGGG + Exonic
929447155 2:42010653-42010675 GCCCCAGCTTTCTGAAGTCCTGG + Intergenic
929571313 2:43024740-43024762 CGCCCTGCTCACAGATGTCCAGG + Intergenic
930579469 2:53193059-53193081 GACACAGCTCACTGTAGTCCTGG - Intergenic
931763854 2:65437624-65437646 GCCCCAGCTGACCGAATCCCTGG - Intergenic
942048397 2:172115054-172115076 GGCCCAGCTCACCTTCTTCCAGG - Intergenic
942098585 2:172556336-172556358 GGCCGCACTCACCGAAGTCCAGG - Exonic
946399595 2:219461432-219461454 GGCCCAGCTCACCCAAGAAATGG + Intronic
946433667 2:219638594-219638616 ACCCCAGCTCCCTGAAGTCCTGG + Intronic
946766008 2:223041655-223041677 GGCCCAACCCACAGAAATCCTGG - Intergenic
948808892 2:240465091-240465113 GGCCCAGCTCCGCGACGTCCAGG + Exonic
1173169370 20:40711322-40711344 GGCCCAGCTCACAGGACACCTGG + Intergenic
1173520004 20:43692298-43692320 TGCCCAGCCCACGGAAGGCCAGG + Exonic
1175828687 20:61950768-61950790 GTCCCAGCTCCCCGAAGGGCAGG + Intergenic
1175871643 20:62212057-62212079 GGTCCAGCTCACAGAAGCTCAGG + Intergenic
1176215207 20:63944650-63944672 GGCCGCGCTCACTGATGTCCCGG + Exonic
1177384239 21:20388456-20388478 TGCCCAGCTCAAGGAGGTCCTGG + Intergenic
1178846930 21:36181789-36181811 GGCCCAGCCCACCCAAATCACGG - Intronic
1178860540 21:36285538-36285560 GGCCCAGCCCCCCTGAGTCCTGG + Intronic
1179981154 21:44896648-44896670 GGCCCAGCTCTCCCAAGACAGGG - Intronic
1180642849 22:17313299-17313321 GACAGAGCTCACAGAAGTCCAGG + Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1180997860 22:19974324-19974346 GCCCCAGCTCACCCACGCCCTGG - Intronic
1183334726 22:37240134-37240156 AGCCCAGCCCACCCAAGTCTGGG + Intronic
1183667405 22:39253721-39253743 GGCCCTGCCCACTGCAGTCCCGG - Intergenic
1184278012 22:43421315-43421337 GGCCCTGCTCAGAGAAATCCGGG - Intronic
949725725 3:7042132-7042154 GGAGCAGCTCACAGAAGTCAGGG - Intronic
953213445 3:40896819-40896841 GCACCAGCTCGCCGCAGTCCTGG + Intergenic
954630817 3:52046850-52046872 GGACCAGCTCCCCGGGGTCCAGG + Intergenic
962501130 3:135994263-135994285 GGCCCAGGTCACCAAAAACCAGG - Intronic
962829969 3:139131277-139131299 GGCATAGCTCAGCGAAGCCCTGG - Intronic
966914310 3:184576422-184576444 TGCCCGGCACACCGAAGGCCAGG - Intronic
968234977 3:197026193-197026215 GGCCAAGGTCACAGAAGTCATGG + Intronic
969027248 4:4183412-4183434 GTCCCAGCTCACAGATGACCTGG - Intergenic
969337773 4:6521851-6521873 GGCACAGCTCACGGAAGAGCCGG + Intronic
971425999 4:26516103-26516125 GGCCCAGCTCACCAGACTCCAGG + Intergenic
973533888 4:51861386-51861408 GGCCCAGCTCACCGAAGTCCTGG + Intronic
984436518 4:179717292-179717314 GAGCCAGCTCACCTAACTCCTGG - Intergenic
985518910 5:361537-361559 GGCCCCACTCTCCGAAATCCAGG - Intronic
999231799 5:150066063-150066085 GGCCCAGCCCACCCACCTCCAGG - Intronic
1006681413 6:35799185-35799207 GGCTCACCTCACAGAGGTCCTGG - Intergenic
1007166180 6:39830622-39830644 GGCCCACCTCCCCCAAGGCCAGG + Intronic
1007177462 6:39906641-39906663 GGCCCAGCTGGCTGGAGTCCAGG - Exonic
1011211501 6:84960408-84960430 GTCCCAGCTCCTAGAAGTCCAGG + Intergenic
1011364095 6:86561703-86561725 AGCCTAGCTCACCAAAGGCCTGG - Intergenic
1018962345 6:168457761-168457783 GGCCCAGCTCGGCGAAGGCCTGG + Intronic
1019275292 7:172833-172855 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275353 7:172983-173005 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275366 7:173013-173035 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275379 7:173043-173065 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019275390 7:173073-173095 GGCCCAGGTCAGCCCAGTCCGGG + Intergenic
1019403133 7:867816-867838 GGCCCAGCTCACTGAACGTCAGG + Intronic
1019655984 7:2196066-2196088 GGCACAGCTCACCATACTCCAGG + Intronic
1026163410 7:67889729-67889751 TGCCCAGCTGCCCAAAGTCCGGG + Intergenic
1026572230 7:71541277-71541299 GGCCCAGCACACATAAGGCCAGG - Intronic
1026620049 7:71942291-71942313 GGCCAGGGTCACCGAGGTCCTGG + Intronic
1027592605 7:80134917-80134939 GGCTCAGCGCCCCCAAGTCCCGG - Exonic
1036207059 8:6813389-6813411 GCCCCTGATCACAGAAGTCCTGG + Intronic
1036392312 8:8334192-8334214 GCCTCAGCTCACCAAAGTACTGG - Intronic
1038094610 8:24293949-24293971 GGCCCAGCAGGCGGAAGTCCTGG - Intergenic
1048807929 8:138257923-138257945 AGCCCAGCACTCCCAAGTCCAGG - Intronic
1049108214 8:140626624-140626646 GGCCCACCTCACTGGAATCCTGG - Intronic
1049644320 8:143729266-143729288 GGACCTGCTCAGCGAAGTGCTGG - Exonic
1055589061 9:77790772-77790794 GGCCAAGGTCACTGAAGGCCAGG - Intronic
1059286666 9:113178642-113178664 GGGCCAGCTCACCAAAGTGCAGG - Exonic
1061667973 9:132171313-132171335 TGCCCACCTCACCGACTTCCTGG + Intronic
1061681606 9:132245207-132245229 GGCCCAGCTGACGGAGGTCAAGG - Intergenic
1061802697 9:133120956-133120978 GCCCCAGCTCACCCACCTCCGGG + Exonic
1062495172 9:136828141-136828163 CCCCCAGCTCCCCCAAGTCCAGG - Intronic
1062607460 9:137354555-137354577 GGCCCAGCTCACCCAGCTCTGGG + Intronic
1197119211 X:122870204-122870226 GGCCCAGCTCACTGCAGCCTTGG + Intergenic
1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG + Intronic
1198806391 X:140499507-140499529 GCCCCAGCTCCCCGCAGCCCAGG + Intergenic
1201524547 Y:14917347-14917369 GGCTCAGCTTCCCAAAGTCCTGG - Intergenic