ID: 973534903

View in Genome Browser
Species Human (GRCh38)
Location 4:51871590-51871612
Sequence TTCCAATAGCAGTCACGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973534903_973534908 16 Left 973534903 4:51871590-51871612 CCAAACCGTGACTGCTATTGGAA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 973534908 4:51871629-51871651 CCTGCATATACATCTAAGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 119
973534903_973534905 12 Left 973534903 4:51871590-51871612 CCAAACCGTGACTGCTATTGGAA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 973534905 4:51871625-51871647 TCTTCCTGCATATACATCTAAGG 0: 1
1: 0
2: 1
3: 18
4: 178
973534903_973534906 15 Left 973534903 4:51871590-51871612 CCAAACCGTGACTGCTATTGGAA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 973534906 4:51871628-51871650 TCCTGCATATACATCTAAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973534903 Original CRISPR TTCCAATAGCAGTCACGGTT TGG (reversed) Intronic
903637077 1:24828321-24828343 TTCCAGTAGCTGCCATGGTTTGG + Intronic
909232810 1:73113450-73113472 TTGAAATAGCAGTCAAGTTTTGG - Intergenic
1075190352 10:120301453-120301475 TTCCAATAGCTTTCAGGATTTGG - Intergenic
1081999084 11:47383114-47383136 TTCCAAGAACAGGAACGGTTTGG + Intergenic
1101856886 12:108451163-108451185 TTACAATAGCAGGCTGGGTTTGG - Intergenic
1104937637 12:132375060-132375082 TTCCCACAGCTGTCACAGTTTGG + Intergenic
1105573122 13:21622832-21622854 TTTGAAGAGCAGTCAGGGTTAGG + Intergenic
1105776697 13:23668896-23668918 TTCAAATAGCAGTCAAGATTTGG + Exonic
1114528455 14:23380564-23380586 TTCCCATAGCATTCACTGTGGGG - Intergenic
1116860894 14:49994867-49994889 TATCAAGAGCAGTCACTGTTGGG + Intronic
1121871461 14:97411943-97411965 CTCCAATAGAAGTCATTGTTGGG - Intergenic
1131558780 15:93421798-93421820 CTCCAAGAGCATGCACGGTTTGG + Intergenic
1148679758 17:49466809-49466831 TTCCCATAGCAGTCCCTGTCTGG - Intronic
1150597656 17:66620619-66620641 TTCCAGTAGCAGACACTGCTAGG - Intronic
1154165945 18:12014629-12014651 CTCCAGTCGCAGTCACGATTTGG + Intronic
942561786 2:177227605-177227627 TTCAAATATCAGTCAATGTTAGG + Intronic
944192847 2:197022074-197022096 TTCTTGTAGCAGTCAAGGTTTGG + Intronic
1175870551 20:62207608-62207630 TTCGAACAGCAGGCAGGGTTGGG - Intergenic
1179962517 21:44777283-44777305 TTCCAAAAGCACTTACTGTTGGG + Exonic
1180611250 22:17099673-17099695 TTCGCATAGCAGTCAAGTTTGGG - Intronic
1183400267 22:37599557-37599579 TACCAATAGCAGCCACCATTTGG + Intergenic
1185273862 22:49941548-49941570 TTCCAAGAGCGGACACGGCTGGG + Intergenic
949564068 3:5228989-5229011 TTCCAAGATCTGTCAGGGTTAGG - Intergenic
956040422 3:65139519-65139541 CTCCAGTAGCTGTCAGGGTTGGG - Intergenic
957910995 3:86619993-86620015 TTTCAATTGCAGTTAGGGTTTGG - Intergenic
963663863 3:148157621-148157643 TACCAAAGGCAGTCACTGTTAGG - Intergenic
964388124 3:156170750-156170772 TTCCAATAGGACTCAATGTTTGG - Intronic
966090989 3:176135833-176135855 TTCAGATAGCAGTCAGAGTTAGG - Intergenic
973534903 4:51871590-51871612 TTCCAATAGCAGTCACGGTTTGG - Intronic
979981450 4:127261006-127261028 TTGCAATAGGAGTTAGGGTTTGG - Intergenic
980189554 4:129506726-129506748 TTACAATAAAAGTCACGGCTGGG + Intergenic
980382123 4:132035702-132035724 TTTCACTAGCACTCATGGTTTGG + Intergenic
988143932 5:27279654-27279676 TTCCTATAGCTGTCACTTTTTGG - Intergenic
990868609 5:60406987-60407009 TTCCAATTTCAGTCACATTTCGG - Intronic
992525598 5:77606967-77606989 TTCCCACAGAAGTCACAGTTTGG - Intronic
992816361 5:80443786-80443808 TTCCAATAGCAGGCACTGGTGGG - Intronic
1001510175 5:172315023-172315045 TTCCAAAAGCAGTCCAGGTATGG - Intergenic
1002764099 6:224979-225001 TTCCAAGAACAGTCACTGGTTGG - Intergenic
1004065619 6:12241086-12241108 TTCCAAGAGCAGTAAGGATTGGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014700436 6:124680157-124680179 TTCAAATAGCCGTCAAGTTTTGG - Intronic
1017476588 6:154800079-154800101 TTTAAATAGCAGTCACGGCCAGG - Intronic
1018233524 6:161700141-161700163 TTCCAATTGCAGTGCCTGTTTGG + Intronic
1021155972 7:17210295-17210317 AGCCAATAGCAGTCACTGGTGGG + Intergenic
1021427512 7:20519216-20519238 TTCCAATAGATGTCACCATTGGG - Intergenic
1042963958 8:74330997-74331019 TTCCAATAGCATTCATGCTGAGG + Intronic
1056501815 9:87217098-87217120 AGCCAATAGCAGGCACTGTTGGG + Intergenic
1057102695 9:92378132-92378154 TTCCAATAGCAGTACCCGATTGG + Intronic
1059222588 9:112639182-112639204 TTCCAATAAAAGACACTGTTAGG - Intronic
1060381388 9:123176976-123176998 TTCCATTGCCAGGCACGGTTAGG - Intronic
1060491034 9:124084546-124084568 TTCCAATAGCAGTGACTGGTGGG - Intergenic
1198685747 X:139226466-139226488 TTAAAATAGAAGTCACGGTATGG + Intergenic
1199100894 X:143798827-143798849 CTATAATAGCAGCCACGGTTGGG - Intergenic