ID: 973537987

View in Genome Browser
Species Human (GRCh38)
Location 4:51904072-51904094
Sequence TTTAGGTATTTGGTTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973537987 Original CRISPR TTTAGGTATTTGGTTGCTGT GGG Intronic
903073690 1:20744629-20744651 TTTAGGCATTTGCTAGCTTTAGG - Exonic
904252452 1:29234936-29234958 TTTATGTACATGTTTGCTGTTGG + Intergenic
904309260 1:29616623-29616645 TTTAGGTATTAGGATAATGTTGG + Intergenic
904338644 1:29815756-29815778 TTTTGTTATCTGGTTGATGTTGG + Intergenic
905149445 1:35915756-35915778 TTTAAGTAGTTGGTTCATGTTGG + Intronic
906049563 1:42859077-42859099 TTGAGGTTTTTGTGTGCTGTAGG - Intergenic
906262343 1:44403790-44403812 TTTATGTATATGTGTGCTGTTGG - Intergenic
906643852 1:47458674-47458696 TTTAGGGATGTGTTTGCTCTTGG + Intergenic
906910795 1:49947199-49947221 TTTTGGTATTTGGGTGATATTGG - Intronic
908283544 1:62568689-62568711 TTTGGGTTTTTTGTTGTTGTTGG - Intronic
908753169 1:67444192-67444214 TTTAGTTATTTCGTTGTTGTTGG - Intergenic
909298890 1:73985509-73985531 TTTTGGTATTAGGGTGCTATTGG + Intergenic
910635328 1:89401650-89401672 TTTTGGTATTAGGATGATGTTGG + Intergenic
910683620 1:89893082-89893104 TTTATGTTTTTGGTTGCTTATGG - Intronic
910736552 1:90464666-90464688 GTGATGCATTTGGTTGCTGTAGG - Intergenic
911178098 1:94837472-94837494 TTTAGGTTTTTGGTTTCTGTGGG + Intronic
911835445 1:102613163-102613185 CTTTGGTATTTGTTTGCTCTTGG - Intergenic
912278730 1:108290096-108290118 GTTAAGTATTTGGGGGCTGTTGG - Intergenic
912289496 1:108404261-108404283 GTTAAGTATTTGGGGGCTGTTGG + Intronic
914778231 1:150758392-150758414 TTTATGTATTTGCATGCTCTCGG - Intronic
915159228 1:153905144-153905166 TTTATGTATTGTGTTGCTCTTGG - Intronic
915750760 1:158207828-158207850 AATATGTATTTCGTTGCTGTTGG + Intergenic
917992277 1:180393739-180393761 TTTAGTTAATGGGTTGCTTTTGG - Intronic
918431193 1:184462494-184462516 TATAGGTATTTGGCTGTTGAGGG + Intronic
918576365 1:186065418-186065440 TTAATGTATTTGGTAGGTGTGGG + Exonic
918956433 1:191214501-191214523 TTTTGGTATTAGGATGATGTTGG + Intergenic
919485342 1:198139329-198139351 TTTGATTCTTTGGTTGCTGTTGG + Intergenic
919576119 1:199311694-199311716 TTTCTTTATTTGGGTGCTGTTGG - Intergenic
919578391 1:199339839-199339861 GTTTGGTATTTGTTTGCTGTTGG - Intergenic
921468546 1:215521138-215521160 TTCATGTATTTGTTTGATGTCGG - Intergenic
922375519 1:224960416-224960438 TTTATGTGTTTGGTTGCTTAAGG + Intronic
922589760 1:226765937-226765959 TTTGCTTATTTGATTGCTGTTGG - Intergenic
924148434 1:241101566-241101588 ATTTGGTATTTGGTTATTGTTGG - Intronic
1063115678 10:3069580-3069602 TTTTGGAATTTAGGTGCTGTGGG + Intronic
1064469827 10:15624701-15624723 TTAAAATATTTGGGTGCTGTGGG - Intronic
1067229010 10:44394079-44394101 GTTTGGTTTTTGGTTGCTTTGGG + Intergenic
1067281628 10:44877764-44877786 TTTAGATATTTTCTGGCTGTTGG - Intergenic
1070677963 10:78426517-78426539 TATACGTATTTTGTTGTTGTTGG + Intergenic
1071461331 10:85899708-85899730 TTTAGGTTTCTGCTTGCTGTGGG - Intronic
1071960032 10:90801194-90801216 TTTTGGGATTTGGTAGCTGAAGG + Intronic
1072045228 10:91647817-91647839 TTTTGGTATTAGGATGATGTTGG - Intergenic
1075143481 10:119862577-119862599 TTTATGTATTTGCTTGCTGAAGG + Intronic
1075176537 10:120168502-120168524 TTTTGGTATTTGTTTTATGTTGG + Intergenic
1075868875 10:125753170-125753192 TTAAGTTTTTTTGTTGCTGTTGG + Intronic
1075982450 10:126752362-126752384 TTTTGGTATTAGGGTGATGTTGG + Intergenic
1077946015 11:6899373-6899395 ATTAAGTATTTGGTTTCTGAAGG + Intergenic
1078950722 11:16130739-16130761 TTTAGGTATTAGGATGGTATTGG + Intronic
1080233990 11:30047588-30047610 TTTAGTTATTTGTATGCTTTTGG - Intergenic
1081550846 11:44110504-44110526 TTTATGGATTTGGTTGTTCTGGG + Intronic
1083064653 11:59912416-59912438 TTTTGGTGTGTGCTTGCTGTAGG + Intergenic
1085265525 11:75235847-75235869 TTTTGGTCTTTGTCTGCTGTTGG - Intergenic
1086606814 11:88705383-88705405 TTTAGGTATTTTCTGGCTTTAGG + Intronic
1090688512 11:129152390-129152412 TTTTGGTATTTGGGTGATGTTGG - Intronic
1090864470 11:130686391-130686413 TTTTTGAATTGGGTTGCTGTGGG - Intronic
1092575360 12:9776613-9776635 TTTTGGGATTTGGTAGCTGAAGG + Intergenic
1092680699 12:10977070-10977092 TTTAGGTATTAGGGTGCTGCTGG - Intronic
1095813425 12:46396053-46396075 TTTAGGTACTTGAGTGCTGTGGG + Intergenic
1096554926 12:52397686-52397708 TTTTGTTATTTGGTTACAGTAGG + Intronic
1096605761 12:52764938-52764960 GTTAGGTTTTTGGTTGGGGTGGG + Intergenic
1098194922 12:67989645-67989667 TTTAGGTTTTTAGCTCCTGTGGG + Intergenic
1098734948 12:74089047-74089069 TCTAGGTCTTTTGTTGCTTTCGG + Intergenic
1099063507 12:77943769-77943791 TTGTGGCCTTTGGTTGCTGTTGG + Intronic
1099699477 12:86065216-86065238 TTTTGGTATTAGGATGCTGCTGG - Intronic
1100203242 12:92321938-92321960 TTTAGGTATTAGGGTGATGCTGG + Intergenic
1102185797 12:110947637-110947659 TTTTTGTATTTGTTTGCTATGGG + Intergenic
1103220927 12:119244407-119244429 TTTAGATAATTCTTTGCTGTGGG + Intergenic
1105327026 13:19380131-19380153 GTTTGGTTTTTGTTTGCTGTTGG + Intergenic
1105562769 13:21510638-21510660 TTTTGTTGTTTGGTTGCTGATGG - Intronic
1106004351 13:25754995-25755017 TTTGGGTTTTTTGTTGTTGTTGG + Intronic
1106921067 13:34563612-34563634 TTTAGGTATTAGGGTGATGCTGG - Intergenic
1108712544 13:53047888-53047910 CTTAAATATTTTGTTGCTGTCGG + Intronic
1109224234 13:59673332-59673354 TTTAGGAATTTCGATGCTTTGGG - Intronic
1109596601 13:64564170-64564192 TTTTGGTATTTGGATGATGCTGG + Intergenic
1110175651 13:72552420-72552442 TTTTGGTAACTGGTTGCTATGGG - Intergenic
1110200729 13:72846950-72846972 TTTAGAAATTAGGTGGCTGTTGG + Intronic
1110997603 13:82132990-82133012 TTTTGGTATTAGGCTGATGTTGG + Intergenic
1111750567 13:92326439-92326461 TATATGTATTTGTTTGCTGTTGG + Intronic
1112538180 13:100282140-100282162 TGTAGGTATTTGCTTATTGTTGG + Intronic
1113486769 13:110658994-110659016 TTTAGGTGTTTGGATTATGTAGG + Intronic
1114818004 14:25982843-25982865 TTTTGGTATCAGGTTGATGTTGG - Intergenic
1114829283 14:26119981-26120003 TTTAGGTTTTGGGATTCTGTGGG + Intergenic
1118162603 14:63305345-63305367 TTTTGGTATTAGGGTGATGTTGG - Intergenic
1118531827 14:66714963-66714985 TTTTGGTATTAGGGTGATGTTGG + Intronic
1119969722 14:78956571-78956593 TTTAGGTATTTGGATCCTTTTGG + Intronic
1120245247 14:81998519-81998541 TTTAGTTTTTTGGCTGCTCTAGG + Intergenic
1120841915 14:89093506-89093528 TTTAAGTACTTGGTTATTGTTGG - Intergenic
1124268368 15:28257722-28257744 TATATGTATTTTGTTGTTGTTGG - Intronic
1125765714 15:42134198-42134220 TTTATGTATTTGGTGACTGTTGG - Intergenic
1126018573 15:44376792-44376814 TTTAGGTATATAGTAGGTGTGGG + Intronic
1126655856 15:50976780-50976802 ATTAGGTATTTTGTTCCTTTTGG - Intronic
1127487652 15:59434439-59434461 TTTAGTTATCAGATTGCTGTGGG - Intronic
1127701645 15:61507019-61507041 TTTATTTCTTTGCTTGCTGTTGG + Intergenic
1128935172 15:71739997-71740019 TTTAGGTCTTTGGTTCTTCTTGG + Intronic
1129639488 15:77360349-77360371 TTTATTTTTTTGGTTGCTTTTGG - Intronic
1130187086 15:81694396-81694418 TTTATCTATTTGATTTCTGTTGG - Intergenic
1130895868 15:88170017-88170039 TTTAGGTCTTTGGCTTCAGTGGG - Intronic
1134345173 16:13383953-13383975 TTAAAGTATTAGGTTGGTGTTGG - Intergenic
1135625041 16:23987382-23987404 TCTGGGTATTTGGTTGGGGTGGG + Intronic
1138259897 16:55610253-55610275 TTTTGGTATTAGGATGATGTTGG + Intergenic
1138550643 16:57746253-57746275 TTTAGGTTCTAGGTTGCTATTGG + Intronic
1145087424 17:19954074-19954096 TTTAGATATTTGGTTGAATTGGG - Intronic
1146754441 17:35415363-35415385 TTTAAGTCTTTGATTCCTGTTGG - Intronic
1149114515 17:53076250-53076272 TTTTGGTATCAGGTTGATGTTGG + Intergenic
1149392850 17:56209320-56209342 TTTTGGTATTTGGGTGATATTGG - Intronic
1150512043 17:65764225-65764247 TCTTGGTATTTTGTTGCTGTTGG + Intronic
1150943455 17:69718822-69718844 TTTTAGCTTTTGGTTGCTGTTGG + Intergenic
1152356164 17:79808657-79808679 AGTAGGTATTTGGTAGCTCTGGG - Intergenic
1153193877 18:2571784-2571806 TTTTGGTGTTTGTTTGCTGTTGG + Intronic
1154076411 18:11206314-11206336 TTCAGCTATTTGGCTGTTGTTGG - Intergenic
1155016905 18:21852148-21852170 GTTAGGTAATTTGTTGGTGTTGG + Intronic
1155567611 18:27153406-27153428 TTTAGGTTTCTGGTGGCTCTAGG + Intronic
1157241783 18:46016823-46016845 CTTAGGTATTTTATTGCTGAGGG - Intronic
1157421601 18:47551960-47551982 TTCAGGTAATTGGAAGCTGTGGG - Intergenic
1157704972 18:49798489-49798511 TTAATGTTTTTGGTTGTTGTTGG - Intronic
1157738113 18:50068740-50068762 TTTTGCTATTTGGATGCTGAGGG - Intronic
1159278754 18:66256040-66256062 TTTAATTATTTTGTTGCTATTGG - Intergenic
1159574059 18:70154752-70154774 TTGAGTTATTTCATTGCTGTCGG - Intronic
1160311678 18:77798020-77798042 TTTTAGTATTTGTTTTCTGTGGG + Intergenic
1160442757 18:78904769-78904791 TTTGGTTATTTGGTTTCTGCTGG - Intergenic
1164298858 19:23940779-23940801 TTTCTCCATTTGGTTGCTGTTGG + Intronic
1164946710 19:32300786-32300808 AATGTGTATTTGGTTGCTGTTGG + Intergenic
1165221423 19:34319858-34319880 TTTAGGTTGTGGGTTGCTGTTGG - Intronic
1168128952 19:54305161-54305183 TTGAGGTATTTTGTTCCTGCTGG - Intergenic
1168573935 19:57492489-57492511 ATCAGCTATTTGGTTGCAGTTGG + Intronic
1168632918 19:57971399-57971421 TTGAGTGATTTGGTGGCTGTGGG - Intronic
925002229 2:413429-413451 TTTAGGTATTTTTTTCATGTAGG + Intergenic
927196845 2:20553757-20553779 TATAGGGCTGTGGTTGCTGTGGG - Intergenic
928336177 2:30400347-30400369 TGTAGATATTTGGTTGCTGCTGG - Intergenic
928559050 2:32459727-32459749 TTTAGGTCTTTGATTTCTCTTGG + Intronic
928577921 2:32674833-32674855 TTTATGTATTTGGTAGATATGGG + Intronic
929037037 2:37703697-37703719 TTTTGGTATTAGGGTGATGTTGG + Intronic
930706907 2:54513388-54513410 TTTTGGCATTGGGTTGCTCTAGG + Intronic
931834921 2:66088919-66088941 TTTTGGTATTTGGGTGATATTGG - Intergenic
934719692 2:96564910-96564932 TTTATGTATTTTGTTGTTGGTGG + Intergenic
937372791 2:121313614-121313636 TTTTGGTATTTATTTGGTGTGGG - Intergenic
938057652 2:128228760-128228782 TTTGTGTATGTGGTTGCTCTAGG + Intergenic
939207802 2:139130021-139130043 TTTAAGTATTTCTTTGCTTTTGG - Intergenic
939223138 2:139329209-139329231 TTTATTTATTTGGTAGCTTTAGG - Intergenic
939434706 2:142160297-142160319 CTTTGGGATTTGTTTGCTGTTGG - Intergenic
940709100 2:157140808-157140830 TTTTGGTATTAGGTTGATGCTGG + Intergenic
941496818 2:166214979-166215001 AATATGTATTTTGTTGCTGTTGG - Intronic
941678032 2:168365280-168365302 TTTATGGATTTGGCTGCTCTAGG - Intergenic
942638142 2:178031216-178031238 ATTAGGTATGAGGTTTCTGTGGG - Intronic
943297629 2:186158513-186158535 TTTTGGTATTAGGTTGATGCTGG - Intergenic
943621024 2:190148492-190148514 TTTTGGTATTAGGGTGATGTTGG + Intronic
943709069 2:191069873-191069895 TTATGGTCTTTGGTTGCTGTTGG - Intronic
945131711 2:206580703-206580725 TTTTGGTATTAGGTTGATGCTGG + Intronic
945454770 2:210037293-210037315 TTTAGCTATTTCCTAGCTGTTGG + Intronic
945826051 2:214721258-214721280 TTTTGGTATTAGGGTGATGTTGG - Intergenic
946036781 2:216749532-216749554 TTTTGGTATTAGGGTGATGTTGG - Intergenic
946693760 2:222332022-222332044 TTTAGGGATTTGTTTGTTGCAGG + Intergenic
1170215368 20:13885556-13885578 ATTGGGTAATTGGTTGCTGCTGG + Intronic
1170492460 20:16892267-16892289 TTTTGGTATTAGGATGATGTTGG - Intergenic
1170637541 20:18121358-18121380 TTTTGGTATTAGGTTGATGCTGG - Intergenic
1175373791 20:58510812-58510834 ATTATGAATTTTGTTGCTGTTGG + Intronic
1177392955 21:20499850-20499872 TTTAGGATTTTGATTGCTTTGGG + Intergenic
1178988376 21:37329822-37329844 TTTTAGCTTTTGGTTGCTGTTGG - Intergenic
1184546267 22:45170681-45170703 TTTTGGTTTTTTGTTGTTGTTGG + Intronic
949465041 3:4335394-4335416 TTTTGGTATTTGGTAGCTGTAGG - Intronic
950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG + Intronic
951161814 3:19432035-19432057 TTTTGGGATTTGTTTGCTCTTGG + Intronic
952058548 3:29478766-29478788 ATTACGTATTCGGTTGATGTTGG + Intronic
952410289 3:33042863-33042885 TTTAGGTGCTTGGTGGCTGTAGG - Intronic
952590720 3:34950648-34950670 TTTTGGGATTTGTTTGCTCTTGG - Intergenic
955512234 3:59692859-59692881 TTTAGGTCTCTGGTTAATGTGGG + Intergenic
957306207 3:78461610-78461632 TTTAGGCATTTAGAGGCTGTTGG + Intergenic
957652657 3:83029011-83029033 TTTTGGTATTAGGCTGTTGTTGG - Intergenic
957718765 3:83968215-83968237 TTTATGTAATTAGTTGCTGAAGG - Intergenic
958134259 3:89467013-89467035 TTTATGTACTAGGTTCCTGTTGG + Intronic
958606359 3:96363746-96363768 TGTAGTTATTTACTTGCTGTTGG - Intergenic
959291267 3:104477198-104477220 TTTAATTATTTGGTTGATTTTGG - Intergenic
960093659 3:113667144-113667166 TTTACGTATTGGGTCTCTGTTGG - Intronic
960511896 3:118559339-118559361 TTTAGCCATTTGGTTGTTGATGG + Intergenic
961178231 3:124853698-124853720 TACAGGTAATTGGTTGCTTTTGG - Intronic
963664144 3:148160932-148160954 ATTAGGTTGTTGGTTGCTGAAGG - Intergenic
965185135 3:165453504-165453526 TTTAGGTATTAGGGTGATATTGG - Intergenic
965339700 3:167473512-167473534 TTTATGTATTTGGTTTATATTGG + Intronic
965951884 3:174318874-174318896 TTTTGTTTTTTGATTGCTGTAGG - Intergenic
966208311 3:177427186-177427208 TTTAGTTCCTTGCTTGCTGTTGG + Intergenic
966969972 3:185035263-185035285 TTTTGGTATTAGGTTGATGCTGG - Intronic
967415870 3:189217943-189217965 TTTTGTTTTGTGGTTGCTGTTGG - Intronic
968114031 3:196075420-196075442 TTTAGGTATATGCTTGTTATTGG + Intronic
968827009 4:2906059-2906081 TTTATGTATTTGGTTGCCCATGG - Intronic
970217169 4:13771690-13771712 TTTAGGTATTAGGGTGATGCTGG + Intergenic
971840695 4:31848250-31848272 TTTAGTTATTTTGTTACTGGTGG - Intergenic
971900774 4:32655283-32655305 TTTTGGTATTAGGTTGATGCTGG + Intergenic
972833181 4:42837330-42837352 TTTAGGATTTTGGGTGCTTTGGG - Intergenic
973244226 4:47993174-47993196 TTTTGGTATTAGGTTGATGCTGG + Intronic
973530063 4:51827945-51827967 TTTTGGAATTTGTTTGCTCTTGG + Intergenic
973537987 4:51904072-51904094 TTTAGGTATTTGGTTGCTGTGGG + Intronic
973782736 4:54304297-54304319 TTTTGGTATTAGGGTGATGTTGG - Intergenic
973787358 4:54345113-54345135 TTTTGGTATTAGGGTGATGTTGG - Intergenic
974762139 4:66290946-66290968 TTTTGGTATTAGGTTGATGCTGG - Intergenic
975159440 4:71109149-71109171 TTTTGTTTTTTGATTGCTGTAGG + Intergenic
977001840 4:91514368-91514390 GTTATGTATGTGGTTGATGTTGG + Intronic
977342150 4:95772107-95772129 TTTAGTTATTTTGTTACTGGCGG - Intergenic
977732748 4:100373818-100373840 TTTAGGTTTGTGATTGCTCTTGG - Intergenic
977822848 4:101495938-101495960 TTTTGGTATTAGGGTGATGTTGG - Intronic
978045642 4:104123554-104123576 TTTTGGGATTTGTTTGCTCTTGG - Intergenic
978115108 4:105010135-105010157 CTTTGGTATTTGTTTGCTCTTGG + Intergenic
979143155 4:117203847-117203869 TTTAAGTATTTAGTTTCTGTGGG - Intergenic
979745561 4:124208614-124208636 CTGAGGTATTTGGTTTCTCTTGG - Intergenic
979967371 4:127091274-127091296 CTTTGGGATTTGTTTGCTGTTGG - Intergenic
980300048 4:130977959-130977981 TTTTGGTATTAGGATGATGTGGG - Intergenic
980547924 4:134293708-134293730 CTTAGGGATTTGTTTGCTCTTGG - Intergenic
980848650 4:138354454-138354476 TTTGGGTATTAGGATGCTGGAGG + Intergenic
982477315 4:155869153-155869175 TGTAGGTATTTGGGTGGTATGGG - Intronic
982675938 4:158375869-158375891 TTTTGTTATTTGGAGGCTGTAGG + Intronic
982823211 4:159970220-159970242 CCTTGGTATTTGTTTGCTGTGGG + Intergenic
983002624 4:162436591-162436613 TTTTGGTATTAGGCTGATGTTGG + Intergenic
983382099 4:167009168-167009190 TTAAGTTATTTTGTTGTTGTTGG - Intronic
988006265 5:25415843-25415865 TTTTGATATTTGGCTGCTGATGG + Intergenic
988165709 5:27587140-27587162 TTTTGGTATTAGGCTGATGTTGG + Intergenic
988286530 5:29225192-29225214 TTTATTTATTTGTTTACTGTTGG + Intergenic
988710508 5:33769692-33769714 TTAAGGTATTTTGTTGATTTGGG + Intronic
991293431 5:65056099-65056121 TTTTGGTATTAGGCTGCTGTTGG + Intergenic
992113529 5:73518070-73518092 TTTAGTTATTTTGTTACTGAAGG - Intergenic
992244400 5:74804798-74804820 TTTAAGTATTTAGTAGCTTTGGG + Intronic
993183620 5:84587234-84587256 TTTAGGTATTTAGTTTTGGTTGG + Intergenic
993751843 5:91679083-91679105 TTTTGGTATTGGGATGATGTTGG + Intergenic
994270855 5:97774670-97774692 TTTTGGTATTAGGGTGATGTTGG - Intergenic
994944270 5:106365092-106365114 TTTAGGTATTAGGTTTATTTAGG + Intergenic
995566634 5:113437814-113437836 ATTATGGATTTGGTTGCTCTTGG + Intronic
995810836 5:116105444-116105466 TTTTGGTATTAGGATGATGTTGG + Intronic
995891402 5:116956265-116956287 TTTAAATGATTGGTTGCTGTTGG - Intergenic
995955619 5:117773060-117773082 TTTTGGTATTAGGGTGATGTTGG - Intergenic
996632117 5:125645880-125645902 TTTTGGTATTAGGATGCTATTGG - Intergenic
996652277 5:125893548-125893570 TGTATGTATGTGATTGCTGTAGG - Intergenic
996835060 5:127782302-127782324 TTTTGGTATTAGGGTGATGTTGG + Intergenic
997391026 5:133516414-133516436 TTTATATTTTTGGTTGCTTTTGG - Intronic
997488870 5:134255895-134255917 TTTTGGTATTTGGGTGATGCAGG - Intergenic
999374246 5:151075903-151075925 TGTAGGTGTGTGGGTGCTGTGGG - Intronic
1000541486 5:162546548-162546570 TTTGAGTATTTAGTTGCTGAAGG + Intergenic
1001576540 5:172768322-172768344 TTGAGGTATTTGGTTCTTCTAGG + Exonic
1003479956 6:6521743-6521765 TGTATGAATTTGGCTGCTGTAGG - Intergenic
1003789322 6:9525186-9525208 TTTAGCTATTTATTTTCTGTTGG - Intergenic
1004793477 6:19054966-19054988 TTTAGGTATTAGGCTGATGCTGG - Intergenic
1006619272 6:35351445-35351467 TTTAAGTATTGGGAAGCTGTCGG + Intronic
1006628996 6:35417954-35417976 TCTAGTCATTTGGTTTCTGTTGG - Intronic
1008279222 6:49576195-49576217 TTTTTGTATTTGGTAGTTGTCGG + Intergenic
1009576493 6:65468614-65468636 TTTAAGTATTTGGGTGCCTTTGG + Intronic
1010322152 6:74524414-74524436 TTTAGTTATTTGGTCCCTGAAGG - Intergenic
1011020314 6:82805697-82805719 TTTTGGTATCTGGATGATGTTGG + Intergenic
1012221183 6:96651199-96651221 TTTATGCATTTTTTTGCTGTGGG + Intergenic
1012238616 6:96847072-96847094 TTTTGGTATTGGGATGATGTTGG - Intergenic
1013018446 6:106183678-106183700 TTTAGAAATTTGGTTTATGTGGG - Intergenic
1014033011 6:116729558-116729580 TGAAGGTATTTGGTAGCTTTAGG + Exonic
1014275143 6:119379594-119379616 TTTAGGATTTTGTTTGGTGTAGG + Intergenic
1015185127 6:130407289-130407311 TTTAGGGATTTGGTTCATCTTGG + Intronic
1015461602 6:133497749-133497771 TTTAGGGATTTGGTTTATCTTGG + Intronic
1015937684 6:138419385-138419407 TCTAGGTATGTGGTTCCTTTCGG + Exonic
1016847680 6:148584943-148584965 TTTTGGTGTTTGTTTGCTCTTGG + Intergenic
1017505376 6:155064236-155064258 TGTAGGAATTTGGATGTTGTTGG + Intronic
1017756049 6:157530464-157530486 TTTGGATATTGGGTTGCTGTTGG - Intronic
1018009708 6:159658957-159658979 TTTTGGTATTTGGGTGATGCTGG - Intergenic
1019904832 7:4053897-4053919 TTTGGGTTTTTTGTTGTTGTTGG + Intronic
1021467365 7:20960268-20960290 TTTAAATATTTGTTTGCTATAGG + Intergenic
1021683358 7:23157280-23157302 TTTAGATATTTTGTTCTTGTAGG - Intronic
1023533094 7:41179696-41179718 TTGAGGTATTTGGTATCTGCGGG - Intergenic
1023596494 7:41834564-41834586 TTGAGCTATTTGCTTGCTCTGGG - Intergenic
1024316030 7:48017612-48017634 CTTAGTTATCTGGCTGCTGTAGG - Intronic
1026325252 7:69303627-69303649 TTTAGGTAATGTGTTCCTGTGGG - Intergenic
1027496601 7:78894885-78894907 TTTAGATATTTTGTTGCTTAGGG - Intronic
1028024179 7:85816253-85816275 TTTGGTTATTTGGTTGCTCTGGG - Intergenic
1029329606 7:99841138-99841160 TTTTGGAATTTGGTAGCTGAGGG + Intronic
1030903568 7:115154031-115154053 TTTAGCTGTTTGGTTTCTGCTGG + Intergenic
1030994773 7:116346609-116346631 TTTTGCTATTTGTTTTCTGTAGG + Intronic
1031347951 7:120692492-120692514 TTGAGGAATTTGGGTCCTGTTGG - Intronic
1031625454 7:123987263-123987285 TCTAGGTATTTGATGGCTTTTGG - Intergenic
1031888023 7:127260997-127261019 TTTAGTTCTTTGCTGGCTGTTGG + Intergenic
1032107786 7:129049226-129049248 TTCAGCTATTTGGATGCTGATGG + Intronic
1032372899 7:131377763-131377785 TTTAGGTATTTGAATACTGTAGG + Intronic
1032910528 7:136424090-136424112 TTTAGCTATATGCTTTCTGTAGG + Intergenic
1033570317 7:142621417-142621439 TTTAGTATTTTGGTTTCTGTGGG - Intergenic
1033794080 7:144826660-144826682 TTTATTTTTTTTGTTGCTGTTGG - Intronic
1033936504 7:146592344-146592366 TTTAGATATTTGGTTAGTGCTGG + Intronic
1035319789 7:158021420-158021442 TTTAGGTATTTGGTTTTTGCCGG - Intronic
1035481170 7:159186712-159186734 TTTTGGGATTTGTTTGCTCTTGG - Intergenic
1035607062 8:936698-936720 TTTGGTTTTTTAGTTGCTGTTGG + Intergenic
1035997965 8:4570629-4570651 TTTTGGTATTTGGATGATGCTGG + Intronic
1037841737 8:22249891-22249913 TGTATGTATTTGTTTGCTGTGGG + Intronic
1039144773 8:34435412-34435434 ATTAGTTGCTTGGTTGCTGTTGG + Intergenic
1039268673 8:35856263-35856285 TTTAGGTATTAGGGTGATGCTGG - Intergenic
1040657002 8:49522092-49522114 TTTAATTATTTGCATGCTGTGGG + Intergenic
1040711449 8:50194155-50194177 TTTAGGTATTAGGGTGATGCTGG + Intronic
1040911018 8:52519190-52519212 TGTATGAATTTGGTTGCTTTTGG - Intergenic
1041363928 8:57081798-57081820 TTTTGGTATTAGGTTGATATTGG + Intergenic
1041828140 8:62121730-62121752 TTTTGGTGTTTGTTTGCTTTGGG - Intergenic
1041902777 8:63000400-63000422 TTTATGAATTTGGTTTCTTTCGG - Intergenic
1042405459 8:68400055-68400077 TCTAGGTATTAGTTTACTGTTGG + Intronic
1042813882 8:72856708-72856730 TTGAGGTAGTTGGATGCAGTGGG + Intronic
1042981815 8:74538101-74538123 TTTTGGTATTAGGATGATGTTGG + Intergenic
1042981860 8:74538617-74538639 TTTGGGGATTTGTTTGCTCTTGG + Intergenic
1044228563 8:89747913-89747935 TTTATGAATTTGGTTGCTCAAGG - Intergenic
1044398730 8:91744650-91744672 TTGATCTATTTGGTTGCTGTGGG - Intergenic
1044906643 8:97011283-97011305 TATATGTGTTTGGTTGGTGTGGG - Intronic
1044965123 8:97567018-97567040 TTTGGGTACTTGGTTCCTATTGG - Intergenic
1049456577 8:142694698-142694720 TTTGGACATTTTGTTGCTGTAGG + Intergenic
1050301911 9:4267494-4267516 TTCAGATATTTGGGTACTGTGGG - Intronic
1050520966 9:6499339-6499361 TTTAGTAATTTAGTTGCTTTAGG + Intronic
1051843347 9:21423629-21423651 TTTTGGTATTAGGGTGATGTTGG + Intronic
1052396426 9:27944065-27944087 ATTATGTATTTTGTTGTTGTTGG + Intergenic
1052580000 9:30343066-30343088 TTTATCTATTTGGTTGTTGTTGG + Intergenic
1053000126 9:34573389-34573411 TTCAGGGTTTGGGTTGCTGTGGG + Intronic
1053322126 9:37108043-37108065 TTTTGGTCTTTGGTTGGGGTTGG - Intergenic
1054844408 9:69777799-69777821 TTTATGTTTTTCTTTGCTGTTGG + Intergenic
1055141078 9:72877580-72877602 TTTTGGTATTAGGGTGATGTTGG - Intergenic
1055151639 9:73007770-73007792 TTTGTTTATTTGGTTGCTTTTGG + Intronic
1055740426 9:79382473-79382495 TTTAGGAATTTGGTCTTTGTGGG - Intergenic
1056316145 9:85392281-85392303 TCTAGCTGGTTGGTTGCTGTGGG + Intergenic
1057647170 9:96887362-96887384 TTTTGTTATTTGCTTGCTGTTGG - Intergenic
1062515522 9:136932970-136932992 TTTTGGTATCAGGGTGCTGTGGG + Intronic
1185506481 X:635031-635053 TATATATATTTGTTTGCTGTTGG - Intronic
1185756012 X:2653605-2653627 TTTAGGTATTAGGTAGAAGTAGG - Intergenic
1187092797 X:16115030-16115052 GATATATATTTGGTTGCTGTGGG + Intergenic
1187655910 X:21473718-21473740 TTTAGGTTTTTTGTTGTTGTTGG + Intronic
1188725237 X:33574881-33574903 TTTGGATATTTGTTTTCTGTTGG + Intergenic
1190754754 X:53391842-53391864 GTCAGGTAATTCGTTGCTGTAGG + Intronic
1191182067 X:57574796-57574818 GTCAGGTATTTGGCTGCTGGAGG - Intergenic
1191954463 X:66628846-66628868 TTTAGGTATTAGGGTGATGCTGG - Intronic
1192882674 X:75303661-75303683 TTTAGTTATTTGTTTACTGTTGG + Exonic
1192978503 X:76313470-76313492 TTTTGGTATTAGGGTGATGTTGG + Intergenic
1193785101 X:85751224-85751246 TTTTGGTATTAGGGTGATGTTGG + Intergenic
1194058663 X:89168986-89169008 TATAGGTATTTGGGTGATGCTGG - Intergenic
1194151765 X:90333922-90333944 TTTATGTATTTGGCTACTCTAGG - Intergenic
1194536904 X:95116732-95116754 TTTTGGTGTTTGTTTGCTCTTGG + Intergenic
1194901084 X:99512495-99512517 TTTAGGTATCTGGATGATGCTGG + Intergenic
1195735094 X:108004453-108004475 TTTTGGTATTAGGGTGGTGTTGG - Intergenic
1198277398 X:135108734-135108756 TTTTGGTATTAGGCTGATGTTGG + Intergenic
1198609900 X:138386645-138386667 TTTTGGTATTAGGCTGATGTTGG - Intergenic
1198886083 X:141339288-141339310 TTTTGGTATTAGGGTGATGTTGG - Intergenic
1199376150 X:147111812-147111834 CTGAGGTATTTGTTTGCTCTTGG - Intergenic
1199689426 X:150297117-150297139 TTTAGCTATCTGTTTACTGTGGG - Intergenic
1200498126 Y:3910688-3910710 TTTATGTATTTGGCTACTCTAGG - Intergenic
1201522402 Y:14890062-14890084 TTTTGGTATTAGGATGATGTGGG + Intergenic
1201754232 Y:17469038-17469060 TTTAGGTTTTGGGTAGGTGTAGG + Intergenic
1201847320 Y:18436947-18436969 TTTAGGTTTTGGGTAGGTGTAGG - Intergenic
1202016809 Y:20417256-20417278 TTCAGGTATTTCTTTGCTTTTGG + Intergenic