ID: 973539100

View in Genome Browser
Species Human (GRCh38)
Location 4:51917805-51917827
Sequence CAATTTTAACAGCGTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973539100_973539102 10 Left 973539100 4:51917805-51917827 CCAGGTGCACGCTGTTAAAATTG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 973539102 4:51917838-51917860 TGATTCTTTAAACCATAATTTGG No data
973539100_973539103 11 Left 973539100 4:51917805-51917827 CCAGGTGCACGCTGTTAAAATTG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 973539103 4:51917839-51917861 GATTCTTTAAACCATAATTTGGG 0: 1
1: 0
2: 1
3: 33
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973539100 Original CRISPR CAATTTTAACAGCGTGCACC TGG (reversed) Intergenic
900727482 1:4226559-4226581 GGATTTTAACAACCTGCACCAGG + Intergenic
909522577 1:76586852-76586874 CACTTTTAACAGCATCCACTTGG - Intronic
911662437 1:100516984-100517006 TAAAGTTAACATCGTGCACCAGG - Intronic
911861880 1:102961909-102961931 CACTTTTCCCAGGGTGCACCTGG - Exonic
919687857 1:200500964-200500986 CAAGTCTTACAGCGTGCAGCTGG + Intergenic
920936604 1:210440710-210440732 CAATTTCAACACTGTGTACCTGG + Intronic
921367929 1:214392221-214392243 TAATTTTGAGAGCGTGCCCCAGG + Intronic
922848868 1:228713843-228713865 CAGTTCTAACAGCATCCACCTGG - Intergenic
1068374731 10:56164272-56164294 AAATTTCAACAGCATGCAACAGG + Intergenic
1077306714 11:1871868-1871890 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306740 11:1871962-1871984 CAACTCTACCAGCGTGCGCCAGG - Intronic
1077306762 11:1872056-1872078 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306786 11:1872150-1872172 CAACTCTACCAGCATGCACCAGG - Intronic
1077306885 11:1872525-1872547 CAACTCTACCAGCGTGCACCAGG - Intronic
1077306908 11:1872619-1872641 CAACTCTACCAGCGTGCACCGGG - Intronic
1084769955 11:71336181-71336203 CAATTTCACCACCGTGCACCTGG - Intergenic
1085346359 11:75770532-75770554 CATTTTTAACAGCATGAACAAGG - Intronic
1089971472 11:122696913-122696935 CTATTTTAACAGCTAGCACAGGG - Intronic
1090135341 11:124192219-124192241 CAATTTTGACAGAGTGGACTGGG - Intergenic
1090197890 11:124832646-124832668 CAATTCTAACACCTTCCACCTGG + Intergenic
1090550684 11:127816520-127816542 CAATTTTAACACTGTGCAGATGG + Intergenic
1097137050 12:56865679-56865701 CAATTTGAACAGCCTGGGCCAGG + Intergenic
1099240939 12:80137859-80137881 CATTTTTATCAACGTGAACCAGG - Intergenic
1106612548 13:31297616-31297638 CAATTTTAACACTGTCTACCTGG + Intronic
1108980946 13:56513013-56513035 AAATTTTAACAGCTTCCACAAGG + Intergenic
1120230887 14:81839559-81839581 AAATTTTAACAGCCTGTACCTGG - Intergenic
1122919530 14:104874335-104874357 GAATTTGAACAGGGTGGACCTGG + Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125445170 15:39746491-39746513 CAATTTTAAAAGCATGCAGATGG + Intronic
1140751797 16:78031052-78031074 CCATTTTATCTGCGTGCACATGG - Exonic
1203143844 16_KI270728v1_random:1786597-1786619 CTGTTTTCACAGCGTGGACCTGG + Intergenic
1153181842 18:2444243-2444265 CAAATTTATCAGTGTGCACAGGG + Intergenic
1153952136 18:10066875-10066897 CAGTTTTATCAGCATGCAGCTGG - Intergenic
1156907321 18:42369626-42369648 CAAATTTATCAACGTGCACATGG + Intergenic
1157002280 18:43541663-43541685 CACTTTTAACAATGTGCTCCAGG - Intergenic
1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG + Intergenic
1158284062 18:55859313-55859335 CAATTTTGCCTGCGTGCACTGGG - Intergenic
1158845108 18:61433743-61433765 CAAATATAACAGCAAGCACCAGG - Intronic
1162864715 19:13536778-13536800 CAAATTTCACAGGGAGCACCGGG - Intronic
1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG + Exonic
1167319187 19:48785399-48785421 TAGTTTTAACAGCATGCACCTGG - Intergenic
929827468 2:45320265-45320287 GAAATTAAACAGCTTGCACCAGG - Intergenic
933419624 2:82029125-82029147 CAATTTAAACATCCTGCATCTGG - Intergenic
941405631 2:165084076-165084098 AAAGTTTAACAGAGTGAACCAGG - Intergenic
941900681 2:170675380-170675402 CAATTTTAACAGGGTGGTCCAGG + Intergenic
942675970 2:178427302-178427324 CAATTTTTAAAGCTTCCACCTGG + Intergenic
944233441 2:197419014-197419036 GGATTTTAACAGCTTGCAACAGG - Intronic
948389692 2:237603021-237603043 CAATTCTAACACTGTCCACCTGG - Intergenic
950893050 3:16422245-16422267 CAATTTCAACAGAGTTTACCAGG + Intronic
955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG + Intergenic
968778497 4:2560591-2560613 CAAAGTTAACTGCGTGCTCCAGG + Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
975447022 4:74477586-74477608 AAATTTTAAAAGTGTGCACTAGG + Intergenic
977525735 4:98143413-98143435 CAATTTTGGTGGCGTGCACCTGG - Intergenic
998573178 5:143283804-143283826 CATTTTTCACAGTGTGCTCCTGG + Intronic
1000349168 5:160339654-160339676 CAACTTTATCAGCGTGTTCCAGG + Intronic
1007878707 6:45137435-45137457 CAATTACAACAACGTACACCAGG + Intronic
1011759583 6:90547377-90547399 TAATTTTAACAGAGTGAATCTGG - Exonic
1011908947 6:92410490-92410512 CAACTTTTACAGCTTCCACCTGG - Intergenic
1011990949 6:93516625-93516647 CACTTTCAACAGCTAGCACCTGG + Intergenic
1015819280 6:137243584-137243606 GAACTTAAACAACGTGCACCAGG + Intergenic
1016546314 6:145228485-145228507 CAATTATAGCTGCGTGCCCCAGG + Intergenic
1021168905 7:17374062-17374084 CAACTTTAACACCTTACACCTGG - Intergenic
1025093910 7:56083377-56083399 CAAACTCAACATCGTGCACCGGG - Exonic
1030589064 7:111458080-111458102 CAATTTTTATAGAATGCACCAGG + Intronic
1033060827 7:138105357-138105379 CAATTTTAACCGCAGGCAGCTGG + Exonic
1033721446 7:144063112-144063134 CAATTTTAAAAACATGTACCTGG + Intergenic
1036049052 8:5175285-5175307 AAATATTATTAGCGTGCACCAGG + Intergenic
1045446225 8:102267417-102267439 CAATATTGACAGCTTTCACCTGG - Intronic
1052023856 9:23553973-23553995 GAATTTTAACAGCCTACTCCTGG + Intergenic
1059761331 9:117340444-117340466 AAAATTTAGCAGGGTGCACCGGG - Intronic
1060565427 9:124586829-124586851 TCATTTTAACAGTGTTCACCAGG - Intronic
1061980811 9:134102451-134102473 CACTTTTGACAGGGTGTACCCGG + Intergenic
1186816573 X:13243638-13243660 CAAATTTATCAGTGTGCACATGG + Intergenic
1199572334 X:149279510-149279532 CAATTTTAATAGGGTGGACATGG + Intergenic
1199886730 X:152027881-152027903 CATTTTTGAGAGTGTGCACCTGG - Intergenic