ID: 973539102

View in Genome Browser
Species Human (GRCh38)
Location 4:51917838-51917860
Sequence TGATTCTTTAAACCATAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973539099_973539102 19 Left 973539099 4:51917796-51917818 CCTTAGAATCCAGGTGCACGCTG 0: 1
1: 0
2: 0
3: 2
4: 82
Right 973539102 4:51917838-51917860 TGATTCTTTAAACCATAATTTGG No data
973539100_973539102 10 Left 973539100 4:51917805-51917827 CCAGGTGCACGCTGTTAAAATTG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 973539102 4:51917838-51917860 TGATTCTTTAAACCATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973539102 Original CRISPR TGATTCTTTAAACCATAATT TGG Intergenic
No off target data available for this crispr