ID: 973539103

View in Genome Browser
Species Human (GRCh38)
Location 4:51917839-51917861
Sequence GATTCTTTAAACCATAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973539100_973539103 11 Left 973539100 4:51917805-51917827 CCAGGTGCACGCTGTTAAAATTG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 973539103 4:51917839-51917861 GATTCTTTAAACCATAATTTGGG 0: 1
1: 0
2: 1
3: 33
4: 294
973539099_973539103 20 Left 973539099 4:51917796-51917818 CCTTAGAATCCAGGTGCACGCTG 0: 1
1: 0
2: 0
3: 2
4: 82
Right 973539103 4:51917839-51917861 GATTCTTTAAACCATAATTTGGG 0: 1
1: 0
2: 1
3: 33
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973539103 Original CRISPR GATTCTTTAAACCATAATTT GGG Intergenic
901429311 1:9202955-9202977 GAGTCTTTAATCCTTAATTCTGG + Intergenic
905746018 1:40418238-40418260 GAGTCTTTATACGAAAATTTTGG - Intronic
906135380 1:43496214-43496236 GATTCTTGAAAGCAGAATATTGG + Intergenic
908517115 1:64904314-64904336 GATTCCAGAAAACATAATTTGGG - Intronic
908553770 1:65236211-65236233 TTTTCTTTAAAAAATAATTTTGG - Intergenic
908700538 1:66894975-66894997 GAATCTATAAATCAAAATTTAGG + Intronic
909398454 1:75197052-75197074 GAAACTTTAAAAAATAATTTTGG - Intergenic
909666211 1:78135868-78135890 TATTCTTTGAAATATAATTTTGG + Exonic
910240617 1:85081989-85082011 AATTGTTTAATTCATAATTTTGG + Intronic
911531507 1:99048886-99048908 AATTTTTTAAAACATGATTTTGG + Intergenic
912209183 1:107540088-107540110 GAGGCTAAAAACCATAATTTTGG - Intergenic
912229862 1:107780340-107780362 GAATCTTTGAAACATAATTAAGG - Intronic
913391896 1:118323064-118323086 GCCTTTTTAAACAATAATTTAGG - Intergenic
914700768 1:150131206-150131228 GATTCTTAAAAATAAAATTTAGG + Intronic
914800030 1:150954152-150954174 AATTTTTTAAAAAATAATTTAGG - Intronic
915388252 1:155517066-155517088 GTTTCTTTAAACAATAATGTTGG - Intronic
915796241 1:158737219-158737241 TATATTTTAAATCATAATTTAGG - Intergenic
916323541 1:163532740-163532762 GATTCATTCAAGCATAATTTGGG + Intergenic
917560348 1:176145976-176145998 AATTCTTTAAACTATAAATTTGG + Intronic
919443031 1:197662948-197662970 GATTCTTTAAAGTAACATTTTGG + Intronic
923634511 1:235681680-235681702 GATTCTTTAATCCAAAATGTAGG + Intronic
1063766174 10:9143007-9143029 AATTCTTTCAACCCTAAATTAGG + Intergenic
1064241154 10:13630558-13630580 AAATCTTTAAAACTTAATTTTGG - Exonic
1065567948 10:27034167-27034189 TTTTTATTAAACCATAATTTGGG - Intronic
1066392483 10:34989009-34989031 GATTTTTTAAAACCTATTTTTGG - Intergenic
1067984155 10:51123293-51123315 GATTTTTTAAACCATATATATGG - Intronic
1068190815 10:53650448-53650470 GCTTCTTTAAATGATAATTTAGG + Intergenic
1068686470 10:59875143-59875165 GAACCTTTAAAGCAAAATTTGGG - Intronic
1069133511 10:64735264-64735286 TTTCCTTTAAACCATAATTTGGG + Intergenic
1070293941 10:75142731-75142753 GTTTCTTTAAAAGATAATTTAGG - Intronic
1071949188 10:90683335-90683357 GATTCTCTAAACCATCCTATTGG - Intergenic
1072320949 10:94249521-94249543 GATTTTTTAATCCCTAGTTTGGG + Intronic
1073611052 10:104943592-104943614 AATTCTATAAACCATAAACTTGG - Intronic
1074145007 10:110709867-110709889 GATTTTTGAAATCATAATTGAGG - Intronic
1075253872 10:120908539-120908561 GTTTCTGTAAACCATAGTTAAGG - Exonic
1077788340 11:5410272-5410294 CATTCTTTGAACTATAATTGTGG + Intronic
1078302614 11:10148182-10148204 TATTCATTAAATAATAATTTGGG + Intronic
1078382308 11:10855245-10855267 TATTCTATAAAACATAATTTGGG + Intronic
1081082348 11:38757766-38757788 GAGTCTATGAACCAAAATTTTGG + Intergenic
1081949136 11:47027794-47027816 GCTTCTTTAAAAAACAATTTAGG - Intronic
1081949290 11:47029304-47029326 GTTACTTTAAATCATAATTTTGG + Intronic
1082226723 11:49716439-49716461 CATTCATTACACCATAATTGTGG + Intergenic
1084080702 11:66822503-66822525 GATTCTCTAAACCACATCTTGGG + Intronic
1085622358 11:78047007-78047029 GATACATGAAATCATAATTTTGG + Intronic
1085866082 11:80294577-80294599 GATCGTTTAAACCATAATGATGG - Intergenic
1085944134 11:81245797-81245819 GATTTTATAAACCAAAATTTTGG - Intergenic
1086159100 11:83701447-83701469 CATCCATTAAACCATCATTTAGG + Intronic
1086622705 11:88906642-88906664 CATTCATTACACCATAATTGTGG - Intronic
1086758657 11:90598718-90598740 GATGCTTTAAAAAATATTTTTGG - Intergenic
1087525366 11:99303925-99303947 GATTATTCAAACCATTTTTTAGG - Intronic
1087771786 11:102218622-102218644 GATTCTTTCAAGTCTAATTTAGG + Intronic
1088049255 11:105491294-105491316 GATGCTTCAAAAAATAATTTAGG + Intergenic
1089042613 11:115467418-115467440 GGTACTTTAATCCATCATTTTGG - Intronic
1089146619 11:116334011-116334033 GATTCTTTGAACCTAAATGTAGG - Intergenic
1091134754 11:133178762-133178784 GATGCTTTAATTCATAGTTTGGG + Intronic
1091483871 12:864409-864431 GAATCTCTAAATAATAATTTAGG - Intronic
1092484957 12:8894746-8894768 GAGTGTTTAAACATTAATTTAGG + Intergenic
1092662058 12:10748990-10749012 CACTCATAAAACCATAATTTGGG - Intergenic
1093709418 12:22312953-22312975 GATATTTTATGCCATAATTTTGG + Intronic
1094236100 12:28168346-28168368 GATTATTTAACTCATAATTCTGG - Intronic
1094239728 12:28208662-28208684 AATTTTTTAAATCATCATTTTGG - Intronic
1094319077 12:29165485-29165507 TATTATTGAAAGCATAATTTTGG + Intronic
1095290226 12:40470492-40470514 TATTCTTTTAAATATAATTTTGG + Intronic
1095329769 12:40945160-40945182 TATTCTTTAAAGTATAATTTTGG - Intronic
1095545575 12:43363916-43363938 TATTCTTTCAACAATATTTTGGG - Intronic
1095580735 12:43794121-43794143 GATTCTTAATGCAATAATTTGGG + Intronic
1096189567 12:49606850-49606872 GATCATATAAACCATAATTTGGG + Intronic
1097475733 12:60053774-60053796 GATTATTCAAACAATAATCTAGG - Intergenic
1097633308 12:62090882-62090904 AATTATTGAAAACATAATTTTGG - Intronic
1098000132 12:65932580-65932602 AATTCTATAAACCTTAATTTGGG + Intronic
1098489263 12:71056063-71056085 GATTCTTTAAGTCATAAGATTGG - Intronic
1100195765 12:92242517-92242539 TAATCTTTAAAGCATGATTTTGG + Intergenic
1101076727 12:101137589-101137611 TATTCTTTAATTCATAATATTGG - Intergenic
1102170487 12:110838774-110838796 GTTTGTTTAAAACAAAATTTAGG + Intergenic
1108504264 13:51096688-51096710 GAGACTTTAAAACAGAATTTTGG - Intergenic
1109486905 13:63036548-63036570 CATTCTTTAAACCTTAATAAGGG - Intergenic
1110200741 13:72847184-72847206 TAATTTTTCAACCATAATTTGGG + Intronic
1111314621 13:86536787-86536809 GATACTTGCAACTATAATTTTGG + Intergenic
1111567738 13:90038452-90038474 GATTTTTTAAACCATAAACTTGG - Intergenic
1111746415 13:92275608-92275630 ATTTCTTTCACCCATAATTTTGG + Intronic
1112004710 13:95244285-95244307 CATTCTTTTAACCCTACTTTTGG - Intronic
1112107696 13:96259913-96259935 GCTGCATTAAACCATGATTTGGG + Intronic
1112673553 13:101670920-101670942 GATGCTGTCAACCATAATTCTGG + Intronic
1113419123 13:110156071-110156093 TATTTTTTAAACAATATTTTAGG - Intronic
1114704283 14:24709805-24709827 GATTTTTAAAAACATACTTTGGG + Intergenic
1114776676 14:25491355-25491377 GATTCATTAATACATAACTTGGG + Intergenic
1115212551 14:30982204-30982226 AATTCATTAAACCTTATTTTAGG - Intronic
1115605683 14:34999817-34999839 TATTCTTTGAACCATCATTATGG - Intronic
1119094817 14:71819742-71819764 GATTTTTTAAACTTTTATTTAGG + Intergenic
1119264607 14:73256591-73256613 GATATTTAAAACAATAATTTGGG - Intronic
1119819560 14:77603047-77603069 GATTCTTGAAACCTTTATTCAGG - Intronic
1120703223 14:87721650-87721672 TCTTCTTTAAAGCATGATTTGGG - Intergenic
1121197571 14:92087733-92087755 CATTCTTTAAACCCTACTGTGGG - Intronic
1124574951 15:30899448-30899470 GATTTTTTAAACTATTAATTAGG - Intergenic
1125372072 15:38988679-38988701 GATGCTATGAACCATTATTTTGG - Intergenic
1126484010 15:49159274-49159296 TATTCTTTAAAAAATAATTCCGG + Intronic
1126501351 15:49348995-49349017 CATTTTTTAAAGCACAATTTGGG - Intronic
1127009234 15:54604241-54604263 CATTCTTTAACTCATACTTTTGG - Intronic
1127753809 15:62070200-62070222 AATTTTTTAAACCCTCATTTAGG - Exonic
1128066662 15:64769160-64769182 GATTTTTTAAAAAAGAATTTAGG + Intronic
1128213094 15:65915966-65915988 AATTCTTCAAACAATAATGTAGG + Intronic
1131400189 15:92119142-92119164 GATACGTCATACCATAATTTAGG + Intronic
1133165633 16:3945229-3945251 GATTCATTATACTATTATTTTGG - Intergenic
1134159111 16:11871179-11871201 GATTCTTAAAACTATAATTATGG - Exonic
1134676420 16:16093730-16093752 GTTTGTTTAAACCACATTTTTGG + Intronic
1135388226 16:22064042-22064064 TATTTTCTAAACCCTAATTTGGG + Intronic
1135967637 16:27049134-27049156 GATTATGTACATCATAATTTTGG - Intergenic
1137810928 16:51351754-51351776 GATTCTTTAAGTCAGAAGTTGGG - Intergenic
1140063118 16:71588764-71588786 CATTATTTAAACCATATTTTTGG - Intergenic
1140251003 16:73294424-73294446 GATTCTTAAAACTATAAAGTGGG + Intergenic
1140286003 16:73603438-73603460 CATTCTTTAAACAATAAGATGGG + Intergenic
1144218882 17:13082014-13082036 CATTCTTTAAATCAAAATTCAGG + Intergenic
1144749113 17:17635965-17635987 GATTTTTTAAATCATTTTTTAGG - Intergenic
1146011947 17:29201953-29201975 GATTCTTAATGCAATAATTTGGG + Intergenic
1146815325 17:35937643-35937665 GATTTTTTGAACCATATTTCTGG + Intronic
1150358688 17:64509774-64509796 GATACTTTAACCCATAACTATGG - Intronic
1150363550 17:64560506-64560528 AATTATTGAAAACATAATTTTGG + Intronic
1154939220 18:21094292-21094314 GATTCTTTAAAAAAGAATTTTGG - Intronic
1155445144 18:25903233-25903255 GATTTTTTAAAATATATTTTTGG - Intergenic
1156831046 18:41491646-41491668 GATTCTTAAAACCATGAACTTGG - Intergenic
1156912907 18:42431926-42431948 CAATCTTTAAACAATAATTTTGG + Intergenic
1157894221 18:51448613-51448635 GTTTCTTTAAACAAAAATGTGGG - Intergenic
1159310330 18:66699154-66699176 AATTTTTTAAACAAGAATTTCGG - Intergenic
1159707753 18:71713902-71713924 GATTCTTTTATACCTAATTTAGG + Intergenic
1159753795 18:72337692-72337714 GATTCATTAAAAAACAATTTGGG + Intergenic
1160039001 18:75328059-75328081 GATTCTTTCATCAATATTTTGGG - Intergenic
1160625242 18:80199957-80199979 AATTTTTTAAAACATAATTGTGG + Intronic
1162879899 19:13650473-13650495 AATTTTTTAAAACATATTTTTGG - Intergenic
1164437109 19:28240201-28240223 GTTTCTTTAAACCATTTATTAGG - Intergenic
926982878 2:18590370-18590392 GATTCTGTAAACCAGAGTTAGGG - Intergenic
927027705 2:19086643-19086665 GATTATTTAAAACAAAATCTAGG + Intergenic
927066388 2:19475375-19475397 GAGTCTTTAAAAGGTAATTTAGG + Intergenic
927368406 2:22326317-22326339 AATTTTTGAAACCATCATTTTGG - Intergenic
928761902 2:34593990-34594012 GATTCTTTGGAACATAGTTTGGG - Intergenic
929012999 2:37465856-37465878 GCTTATTTAAAACATAATTATGG - Intergenic
930701384 2:54460688-54460710 GATTCTTTAACATATATTTTAGG - Intronic
930949333 2:57118839-57118861 GATTATTAATACCATAATTCAGG - Intergenic
931209804 2:60181848-60181870 AATTCTTTAAACCAGAAGTTGGG - Intergenic
931954282 2:67400758-67400780 AATTCTTCAAACCATGTTTTGGG - Intronic
933571637 2:84020736-84020758 GATTCTGTAAACATTAATTTGGG - Intergenic
935197265 2:100824752-100824774 GATTTTTTAAAATATATTTTGGG + Intronic
936234013 2:110727859-110727881 TATACTTTTAACCATTATTTTGG - Intergenic
936671355 2:114660719-114660741 GATTCTTTATAACTTATTTTAGG - Intronic
937030898 2:118739410-118739432 GATTCAGTACACCAAAATTTGGG + Intergenic
937266549 2:120618856-120618878 GATTCTATTTACCATTATTTAGG + Intergenic
939343671 2:140934234-140934256 GAGTCTATAACACATAATTTGGG + Intronic
940598787 2:155829732-155829754 CAATATTCAAACCATAATTTTGG + Intergenic
943522507 2:188971094-188971116 GACTTTTTCAACCATATTTTTGG + Intergenic
943750571 2:191505600-191505622 GATTCTTTACCCCATAAATTTGG + Intergenic
945084541 2:206117887-206117909 CCTTCTTAAAATCATAATTTTGG - Intronic
945412007 2:209521043-209521065 GAAGCTCTAAACCATACTTTGGG - Intronic
946290285 2:218739201-218739223 GAATGTATATACCATAATTTGGG + Intronic
947675260 2:231972929-231972951 AATTTTTTAAACCAGATTTTAGG - Intronic
1170130212 20:13011098-13011120 TATTTTTTAAGCCATAATTGAGG - Intronic
1170688636 20:18591697-18591719 TATTTTTTAAAACATACTTTGGG + Intronic
1172208892 20:33183738-33183760 GCTTATTTAAACCATTATGTTGG + Intergenic
1172733742 20:37110184-37110206 GATGCTTGACAACATAATTTGGG + Intronic
1173954420 20:47019682-47019704 AAGAATTTAAACCATAATTTTGG + Intronic
1175533119 20:59688159-59688181 GTTTCTTTAATAGATAATTTAGG + Intronic
1177036983 21:16056478-16056500 CATTCTTTGAACCATGGTTTAGG + Intergenic
1177209018 21:18046618-18046640 GATTCTGTAGAACATAATTAAGG + Intronic
1177338707 21:19768722-19768744 GTTTCTTTATACAATCATTTCGG + Intergenic
1179323064 21:40311855-40311877 AATTATTTAAAACATATTTTAGG + Intronic
1179371660 21:40811540-40811562 GATTCTTTCCACCAGAAATTGGG + Intronic
1182432282 22:30306674-30306696 GATTTTTTAAATCCTAAATTAGG + Intronic
1184999148 22:48232278-48232300 TATTCATTAACCCATCATTTTGG - Intergenic
949208728 3:1472948-1472970 GAGTCTTTATACCACAAGTTAGG + Intergenic
950636839 3:14321423-14321445 GATTCCTTAAACACTACTTTTGG - Intergenic
951925129 3:27901150-27901172 GATTCTTTGCTCAATAATTTAGG - Intergenic
951956177 3:28256644-28256666 CATTATTTAAACAATAAATTAGG - Intronic
952015927 3:28957866-28957888 TATTCTTTACATTATAATTTAGG - Intergenic
952406027 3:33005959-33005981 GACTCTTCAAAGCATAATTTTGG + Intronic
954768117 3:52939600-52939622 AATACTATAAACTATAATTTAGG - Intronic
955609922 3:60746080-60746102 GATTTTTTAAAACAATATTTTGG + Intronic
956395718 3:68824119-68824141 GATTTTTTAAAAAATAACTTAGG - Intronic
957211145 3:77260487-77260509 GATCCTTAGAACCATGATTTAGG + Intronic
957868805 3:86061309-86061331 GATTTTTAAAACCATAATACTGG + Intronic
958262546 3:91398548-91398570 AATTCTTTAATCCAAAATGTTGG - Intergenic
959238042 3:103749988-103750010 TATTCTCTAAACCAAAATATTGG + Intergenic
959534221 3:107467486-107467508 GTTTCATTAAATAATAATTTGGG + Intergenic
962406593 3:135105866-135105888 GATTCTTTAAAACTAAATTAGGG - Intronic
963404225 3:144842380-144842402 AATTATTTATACCATAATTTGGG + Intergenic
963492993 3:146024488-146024510 CAATCTTTAGACCATAGTTTAGG - Intergenic
963685740 3:148431711-148431733 TATTCTTTCAACAATAATTTTGG + Intergenic
965292248 3:166898350-166898372 TATTCTGTAAACCATGTTTTTGG + Intergenic
965371625 3:167869584-167869606 GATTTGTTAAAGCTTAATTTGGG - Intergenic
966277765 3:178196332-178196354 TTTTTTTTAAACCAAAATTTTGG - Intergenic
966366379 3:179192222-179192244 AATTCCTTCAACCATAATTCAGG - Intronic
966376280 3:179298876-179298898 GATTTTTTAAATCAGAAATTTGG - Intergenic
967595913 3:191326963-191326985 GATTCTCTAAACAATAGTTGTGG + Intronic
968197815 3:196723583-196723605 GGTTCTTCAAACCAGATTTTGGG - Intronic
969048906 4:4358676-4358698 GGGTCTTTAAACCATAAAATTGG - Intronic
969124174 4:4934097-4934119 GGCTTTTTAAATCATAATTTTGG + Intergenic
970475639 4:16419532-16419554 AATTCTTTAAAACATAATTAAGG + Intergenic
971729099 4:30353239-30353261 GAATCTTTAAACCAAACATTTGG - Intergenic
971843799 4:31892663-31892685 GATGATTTAAAGCATATTTTAGG + Intergenic
972006853 4:34120227-34120249 GATTCTTTATATCATAATGCTGG + Intergenic
972385894 4:38565052-38565074 GATTATGTAAAACATAATTAGGG - Intergenic
973246964 4:48019362-48019384 GTTTCTTTTAAAGATAATTTTGG - Intronic
973539103 4:51917839-51917861 GATTCTTTAAACCATAATTTGGG + Intergenic
974105373 4:57463976-57463998 GATTTTTAAAAACATAATTTAGG + Intergenic
974252129 4:59399608-59399630 GATATTTTAATCCATAATTAGGG + Intergenic
974404424 4:61447418-61447440 GATTCTTAAAACAAACATTTTGG + Intronic
975491770 4:74996963-74996985 GATTTTTCAAAAAATAATTTTGG + Intronic
975582042 4:75915676-75915698 GATTCCTTACACCATGCTTTGGG + Intronic
975916777 4:79334575-79334597 CATTCTTTAAACAATAATAATGG - Intergenic
975920030 4:79374418-79374440 GACTCTCTCAAACATAATTTTGG - Intergenic
975927065 4:79469799-79469821 GACTCTTTAAATCAAAATATTGG + Intergenic
976119722 4:81766532-81766554 GATTATCAAAAACATAATTTAGG - Intronic
976967563 4:91063416-91063438 CATTCTTTAACACATAAATTTGG + Intronic
977278877 4:95014117-95014139 CATTCTTTTAACAATTATTTAGG - Intronic
978029582 4:103923884-103923906 GATTTTTTAAATCATATTCTAGG - Intergenic
978174397 4:105711478-105711500 GAAAATATAAACCATAATTTGGG + Intronic
978593242 4:110349550-110349572 GTTTCTTTAAACTTTTATTTTGG + Intergenic
979015156 4:115422927-115422949 AATTTTTTAAATCATTATTTTGG + Intergenic
979074862 4:116258674-116258696 GATTCTTTAAACAGTATTATTGG + Intergenic
979680510 4:123454315-123454337 GATTCTGGAACCCAGAATTTTGG + Intergenic
979724165 4:123940850-123940872 AATTCTATAGACCTTAATTTGGG - Intergenic
980978269 4:139631900-139631922 GATGCTTGAAAGCAAAATTTTGG - Intergenic
981603640 4:146520478-146520500 AATTATTTAAACCAAAATTGTGG - Intronic
982109715 4:152042744-152042766 GATTGATTAAACCACATTTTAGG + Intergenic
982150299 4:152447024-152447046 GATACTTTAAACATTAATTATGG - Intronic
982628222 4:157796214-157796236 GACACTTTAAAACATATTTTTGG + Intergenic
982947600 4:161645233-161645255 CTTTCTTTAAATAATAATTTTGG - Intronic
983009910 4:162535117-162535139 GGTTCTTTAAAACATGATTGAGG + Intergenic
983357173 4:166678094-166678116 TTTTCTTGAAACTATAATTTGGG - Intergenic
983992224 4:174134086-174134108 TATTTTTTAAATAATAATTTGGG + Intergenic
984546419 4:181109692-181109714 GATTCTTCACACCAACATTTGGG - Intergenic
984793734 4:183638307-183638329 GATTGCTTTAACCATAAATTTGG - Intergenic
986698992 5:10386671-10386693 AATTCTTTATATTATAATTTTGG + Intronic
986884723 5:12219114-12219136 GATTCATGAAAACAGAATTTAGG - Intergenic
987447916 5:18044259-18044281 GATTCTTAAAACCATCACTCAGG + Intergenic
987647787 5:20698024-20698046 GATTCTTTAAATTTTAATTCTGG + Intergenic
988748548 5:34170833-34170855 GATTCTTTAAATTTTAATTCTGG - Intergenic
989053043 5:37340133-37340155 GATTTTTTAAAAGATGATTTTGG - Intronic
989388648 5:40878047-40878069 TATTATTTAAATCATAATCTGGG - Intergenic
989488848 5:42026153-42026175 GATTCTTTAATCCATAATCATGG + Intergenic
990276548 5:54203058-54203080 GATTATTTTAAAGATAATTTGGG - Intronic
990839285 5:60058091-60058113 TGTTCTTTAAACCTCAATTTCGG - Intronic
992201655 5:74390337-74390359 GACTCTTTAATGCATATTTTTGG - Intergenic
993118202 5:83742865-83742887 AATTCTTTGAACTATAATTGTGG + Intergenic
993951479 5:94181506-94181528 CATAATTTAAACCATAATATTGG + Intronic
994132264 5:96243766-96243788 GATTCATTTAACCCTACTTTGGG + Intergenic
995155103 5:108901645-108901667 TATTATTTAAAAAATAATTTTGG + Intronic
996017118 5:118551941-118551963 AATGCTTTAAAGCATATTTTTGG - Intergenic
996826634 5:127689487-127689509 TATTCTTTATACCCTCATTTTGG - Intergenic
997001122 5:129763268-129763290 GCTTCTGGAAACCATAACTTTGG + Intronic
1000743476 5:164999597-164999619 GTTTCTTTTAACCCTAATTGAGG + Intergenic
1005356273 6:24986455-24986477 GTTTCTTGAAACAATAATTTAGG + Intronic
1005546125 6:26873933-26873955 GATTCTTTAAATTTTAATTCTGG - Intergenic
1006244956 6:32724851-32724873 GATTATTTAAACCTTAAATAGGG + Intergenic
1009016835 6:57914725-57914747 GATTCTTTAAATTTTAATTCTGG - Intergenic
1010034330 6:71305935-71305957 CATTTTTTAAACTATAATTGAGG + Exonic
1010076932 6:71809425-71809447 GTTTCTTAAGACCATTATTTTGG - Intergenic
1010134180 6:72531295-72531317 GATTTTTAAAACCAAACTTTTGG - Intergenic
1010401808 6:75454609-75454631 ATTTCTTGAATCCATAATTTTGG - Intronic
1010822076 6:80426924-80426946 AAATCTTTAAACTATAATTTTGG + Intergenic
1011350517 6:86418051-86418073 GATTCTTTATATCATAATAATGG - Intergenic
1012187631 6:96239703-96239725 GATTCTTTAAAACATAAATTAGG - Intergenic
1012897339 6:104965685-104965707 GATACTTTAAACAATATTCTAGG - Intronic
1013049419 6:106517675-106517697 GATTCCTTCAACCATAAGTTGGG + Intronic
1013670640 6:112398973-112398995 GTTTCTTCAAACACTAATTTAGG + Intergenic
1014094584 6:117446011-117446033 GATTCCTTGAACAACAATTTTGG + Intronic
1014866814 6:126542418-126542440 CATTCTTTAAACAAAATTTTTGG - Intergenic
1015392455 6:132698096-132698118 GAATTTTTAAACCCTAAATTAGG - Intronic
1016147939 6:140699286-140699308 GATGCTTTAATCATTAATTTAGG - Intergenic
1016972654 6:149778844-149778866 TTTTCTTTAAACCATAGATTAGG + Intronic
1017653378 6:156603408-156603430 CATTCTGTAAAACACAATTTGGG - Intergenic
1017658765 6:156654085-156654107 GAATGTATAAACTATAATTTTGG - Intergenic
1020681920 7:11247135-11247157 TATTTTTTAAATTATAATTTAGG + Intergenic
1022217154 7:28274729-28274751 AACTGTTTAAAACATAATTTTGG + Intergenic
1023533056 7:41179337-41179359 GACTCTTAAAACTAAAATTTAGG - Intergenic
1023543390 7:41290999-41291021 CATTTTTTAAACCATTAATTTGG - Intergenic
1023880759 7:44319745-44319767 CATTTTTTAAACCAAAAATTGGG - Intronic
1027688209 7:81304982-81305004 AAGTCTTTAAATCTTAATTTAGG - Intergenic
1027910019 7:84238478-84238500 CATTCTTTAAACCACAAGTTTGG - Intronic
1028603944 7:92634339-92634361 GAGACTTGAAACCCTAATTTAGG - Intronic
1028767758 7:94579327-94579349 GATTCTTATTACCTTAATTTGGG - Intergenic
1030563124 7:111115975-111115997 TTTTCTTTAAACAATAATTCCGG - Intronic
1030648414 7:112090691-112090713 GATTCTATAAACTATATTCTGGG + Intronic
1031320084 7:120314121-120314143 GATTTTTTAAACCCTAGTATAGG - Intronic
1032417833 7:131751311-131751333 GATTCTGTATACTATAATTATGG - Intergenic
1037029023 8:14078941-14078963 GGGTTTTTTAACCATAATTTAGG + Intergenic
1037209244 8:16365409-16365431 GATTCTTCAACCCATAAGCTTGG - Intronic
1038063332 8:23936631-23936653 TATTCTGTGAACCATACTTTGGG + Intergenic
1038823965 8:30980328-30980350 TATTCTTTATAACATCATTTTGG - Intergenic
1040490632 8:47918485-47918507 ATTTTTTTAAATCATAATTTAGG - Intronic
1040991794 8:53359786-53359808 GAGTCCTTAAACCATATTGTGGG - Intergenic
1041417904 8:57633333-57633355 GATTCTCATAACCATTATTTTGG + Intergenic
1042117852 8:65451514-65451536 GTTTCCTTAAACCAGAACTTTGG - Intergenic
1042285069 8:67100534-67100556 AATTCTTAAAAGCATAACTTGGG - Intronic
1042659812 8:71142057-71142079 AATTCTTGAATTCATAATTTAGG - Intergenic
1042851170 8:73217447-73217469 AATATTTTAAACCATAACTTAGG + Intergenic
1043123381 8:76359987-76360009 GATTTTTTAAAACCTAATATTGG + Intergenic
1043849488 8:85199600-85199622 AATTCTTTAAAAACTAATTTGGG - Intronic
1044270459 8:90236784-90236806 GATTCTTTAATCTATCATGTAGG + Intergenic
1045435686 8:102161487-102161509 GATCCTTTAGAATATAATTTAGG - Intergenic
1046573930 8:116001339-116001361 GTTTTTTTAAACCAAAGTTTTGG + Intergenic
1051025154 9:12600582-12600604 GATTCTTTAAATCAAGAATTAGG - Intergenic
1051238236 9:15024356-15024378 GATTTATTAAAAAATAATTTGGG - Intergenic
1051752999 9:20363806-20363828 GATTCTTTAATAAATATTTTGGG - Intronic
1051794753 9:20853575-20853597 GATTCTCTAAGGCATAGTTTGGG + Intronic
1052757451 9:32555623-32555645 GATTCTGTAAACTATATGTTTGG - Intronic
1052845637 9:33333841-33333863 GGTTATTAAAAACATAATTTGGG + Intronic
1053191234 9:36071240-36071262 AATTTTTTAAATCATAATTTTGG - Intronic
1054799261 9:69330675-69330697 GGATATTTAAACTATAATTTTGG + Intronic
1055126827 9:72728517-72728539 TAATCTTTATACCATATTTTTGG + Intronic
1055286972 9:74739225-74739247 GATTCTTCCTTCCATAATTTCGG - Intronic
1055508778 9:76973824-76973846 GATTCATCACACTATAATTTGGG - Intergenic
1055879200 9:80978497-80978519 AATTCTTTAAAACATTATTCTGG - Intergenic
1058064802 9:100537392-100537414 GAATCTTTAAATGATATTTTGGG + Intronic
1058322706 9:103653788-103653810 GATTAATTAAACAATTATTTTGG - Intergenic
1058774578 9:108271109-108271131 CTTTTTTTAAACCATAGTTTTGG + Intergenic
1059548578 9:115204068-115204090 GATTCTTTAAACTATGTCTTTGG - Intronic
1060054045 9:120398094-120398116 GTATCTAGAAACCATAATTTGGG + Intronic
1060379683 9:123155661-123155683 GATTCTTGAAAACATGATTATGG + Intronic
1060490489 9:124080599-124080621 GTTTTTTTAAAGCATAAATTTGG - Intergenic
1186159911 X:6766352-6766374 GATACTCTAAACCATATTTGAGG + Intergenic
1188375833 X:29426866-29426888 GTTTCTTTTAATCATAAATTTGG + Intronic
1189732054 X:44031876-44031898 GTTTCTTAAAACAATTATTTTGG - Intergenic
1193046796 X:77062427-77062449 AATTCATTCAACTATAATTTGGG + Intergenic
1193857975 X:86628444-86628466 TATTCTTTACATCATAATTCGGG + Intronic
1194244119 X:91490109-91490131 TATTCTTAAAAACATAATATAGG - Intergenic
1194491631 X:94557341-94557363 CATTCTTTAAATGACAATTTTGG - Intergenic
1195619709 X:106940885-106940907 CATTCTTTAAGCCTTAATTTAGG + Exonic
1196486956 X:116223037-116223059 GATTCTTAAAAACACAAGTTGGG - Intergenic
1196583639 X:117404592-117404614 CTTTATTTAAACCCTAATTTAGG + Intergenic
1197003608 X:121469690-121469712 GATTATTTGAGCCACAATTTAGG + Intergenic
1200563099 Y:4731439-4731461 TATTCTTAAAAACATAATATAGG - Intergenic