ID: 973540328

View in Genome Browser
Species Human (GRCh38)
Location 4:51928638-51928660
Sequence TTTCCCACCCCCAGTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973540328_973540332 -7 Left 973540328 4:51928638-51928660 CCAATGCCACTGGGGGTGGGAAA No data
Right 973540332 4:51928654-51928676 TGGGAAAACTGCCTCTACTGGGG No data
973540328_973540333 -1 Left 973540328 4:51928638-51928660 CCAATGCCACTGGGGGTGGGAAA No data
Right 973540333 4:51928660-51928682 AACTGCCTCTACTGGGGATGAGG No data
973540328_973540335 16 Left 973540328 4:51928638-51928660 CCAATGCCACTGGGGGTGGGAAA No data
Right 973540335 4:51928677-51928699 ATGAGGAGAACTCTTACACTTGG No data
973540328_973540330 -9 Left 973540328 4:51928638-51928660 CCAATGCCACTGGGGGTGGGAAA No data
Right 973540330 4:51928652-51928674 GGTGGGAAAACTGCCTCTACTGG No data
973540328_973540331 -8 Left 973540328 4:51928638-51928660 CCAATGCCACTGGGGGTGGGAAA No data
Right 973540331 4:51928653-51928675 GTGGGAAAACTGCCTCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973540328 Original CRISPR TTTCCCACCCCCAGTGGCAT TGG (reversed) Intergenic
No off target data available for this crispr