ID: 973544080

View in Genome Browser
Species Human (GRCh38)
Location 4:51962787-51962809
Sequence AAGAAGAAGAAGAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973544080_973544083 27 Left 973544080 4:51962787-51962809 CCTTTCTCATTCTTCTTCTTCTT No data
Right 973544083 4:51962837-51962859 AGGGTCTTGCTCTGTTGCCCAGG 0: 3404
1: 18030
2: 59862
3: 128720
4: 207756
973544080_973544081 7 Left 973544080 4:51962787-51962809 CCTTTCTCATTCTTCTTCTTCTT No data
Right 973544081 4:51962817-51962839 TTTTTTTTTTTTTTTGAGACAGG 0: 13279
1: 16490
2: 27851
3: 54067
4: 109329
973544080_973544082 8 Left 973544080 4:51962787-51962809 CCTTTCTCATTCTTCTTCTTCTT No data
Right 973544082 4:51962818-51962840 TTTTTTTTTTTTTTGAGACAGGG 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973544080 Original CRISPR AAGAAGAAGAAGAATGAGAA AGG (reversed) Intergenic
No off target data available for this crispr