ID: 973547085

View in Genome Browser
Species Human (GRCh38)
Location 4:51992762-51992784
Sequence TGATGCCAACAGGTGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973547081_973547085 -7 Left 973547081 4:51992746-51992768 CCGGTTGGACTAGTGATGATGCC No data
Right 973547085 4:51992762-51992784 TGATGCCAACAGGTGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973547085 Original CRISPR TGATGCCAACAGGTGGACTA GGG Intergenic
No off target data available for this crispr