ID: 973547142

View in Genome Browser
Species Human (GRCh38)
Location 4:51993289-51993311
Sequence CTAGTTGCCCAAATTCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973547142_973547150 12 Left 973547142 4:51993289-51993311 CCTATATGAATTTGGGCAACTAG No data
Right 973547150 4:51993324-51993346 GAGTCTGGAGCTTAGATGGGAGG No data
973547142_973547147 -3 Left 973547142 4:51993289-51993311 CCTATATGAATTTGGGCAACTAG No data
Right 973547147 4:51993309-51993331 TAGGGTTGGGAATGTGAGTCTGG No data
973547142_973547151 16 Left 973547142 4:51993289-51993311 CCTATATGAATTTGGGCAACTAG No data
Right 973547151 4:51993328-51993350 CTGGAGCTTAGATGGGAGGTAGG No data
973547142_973547148 8 Left 973547142 4:51993289-51993311 CCTATATGAATTTGGGCAACTAG No data
Right 973547148 4:51993320-51993342 ATGTGAGTCTGGAGCTTAGATGG No data
973547142_973547152 17 Left 973547142 4:51993289-51993311 CCTATATGAATTTGGGCAACTAG No data
Right 973547152 4:51993329-51993351 TGGAGCTTAGATGGGAGGTAGGG 0: 1
1: 1
2: 0
3: 30
4: 249
973547142_973547149 9 Left 973547142 4:51993289-51993311 CCTATATGAATTTGGGCAACTAG No data
Right 973547149 4:51993321-51993343 TGTGAGTCTGGAGCTTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973547142 Original CRISPR CTAGTTGCCCAAATTCATAT AGG (reversed) Intergenic
No off target data available for this crispr