ID: 973551302

View in Genome Browser
Species Human (GRCh38)
Location 4:52038325-52038347
Sequence GCGCGCCTGCGCTTGCGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973551289_973551302 15 Left 973551289 4:52038287-52038309 CCCGCCCGACTGTGCCCGCCCCT 0: 1
1: 0
2: 0
3: 23
4: 245
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551294_973551302 0 Left 973551294 4:52038302-52038324 CCGCCCCTCCGCGACCGCACCCT 0: 1
1: 0
2: 0
3: 17
4: 291
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551293_973551302 1 Left 973551293 4:52038301-52038323 CCCGCCCCTCCGCGACCGCACCC 0: 1
1: 0
2: 3
3: 32
4: 507
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551291_973551302 11 Left 973551291 4:52038291-52038313 CCCGACTGTGCCCGCCCCTCCGC 0: 1
1: 0
2: 2
3: 25
4: 255
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551292_973551302 10 Left 973551292 4:52038292-52038314 CCGACTGTGCCCGCCCCTCCGCG 0: 1
1: 0
2: 0
3: 13
4: 208
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551285_973551302 29 Left 973551285 4:52038273-52038295 CCGCCGCCGAGCTCCCCGCCCGA 0: 1
1: 0
2: 1
3: 32
4: 213
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551295_973551302 -3 Left 973551295 4:52038305-52038327 CCCCTCCGCGACCGCACCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551297_973551302 -5 Left 973551297 4:52038307-52038329 CCTCCGCGACCGCACCCTGCGCG 0: 1
1: 0
2: 1
3: 6
4: 108
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551296_973551302 -4 Left 973551296 4:52038306-52038328 CCCTCCGCGACCGCACCCTGCGC 0: 1
1: 0
2: 3
3: 1
4: 140
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551288_973551302 16 Left 973551288 4:52038286-52038308 CCCCGCCCGACTGTGCCCGCCCC 0: 1
1: 0
2: 3
3: 28
4: 313
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551287_973551302 23 Left 973551287 4:52038279-52038301 CCGAGCTCCCCGCCCGACTGTGC 0: 1
1: 0
2: 0
3: 15
4: 151
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551298_973551302 -8 Left 973551298 4:52038310-52038332 CCGCGACCGCACCCTGCGCGCCT 0: 1
1: 0
2: 0
3: 7
4: 114
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551286_973551302 26 Left 973551286 4:52038276-52038298 CCGCCGAGCTCCCCGCCCGACTG 0: 1
1: 0
2: 0
3: 19
4: 131
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
973551290_973551302 14 Left 973551290 4:52038288-52038310 CCGCCCGACTGTGCCCGCCCCTC 0: 1
1: 0
2: 0
3: 23
4: 257
Right 973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973551302 Original CRISPR GCGCGCCTGCGCTTGCGCCC TGG Exonic
900095998 1:940349-940371 GCGCCCCCGCGCTAGCGGCCGGG - Intronic
900172058 1:1273992-1274014 GCGGGGCGGCGCTTGCGCACTGG + Intergenic
901095594 1:6676652-6676674 GCGCGCGTGCTCTGTCGCCCAGG - Intronic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
906640716 1:47439011-47439033 GCACGCCTTCGCTTTCGCCGCGG + Exonic
907880654 1:58546583-58546605 GAGCGCCTGCGGGGGCGCCCGGG - Intronic
911072969 1:93846972-93846994 GCGCGGCGGCGCTCGCGCGCAGG + Intronic
912534745 1:110358289-110358311 GCGCCACTGCGCTAGAGCCCAGG + Intergenic
913671057 1:121097661-121097683 GCCCGCCTGCTCTCGGGCCCCGG + Intergenic
914192781 1:145425612-145425634 CTGCGCCTGCGCCTGCGCCTTGG - Intergenic
915601023 1:156923548-156923570 TCGGGCCTGCGCTTTCTCCCAGG + Intronic
917141633 1:171841457-171841479 GCGCGCCTGCGCGGGCGGGCAGG - Intergenic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
1067538970 10:47137955-47137977 GGGCTCCTGTGCTTGCTCCCAGG - Intergenic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1073494997 10:103882778-103882800 GCTCGCCTGAGCATCCGCCCGGG - Exonic
1076681990 10:132177561-132177583 GCGCACCTGCTCCTGTGCCCTGG + Intronic
1076682021 10:132177825-132177847 GCGCACCTGCTCCTGTGCCCTGG + Intronic
1076682027 10:132177863-132177885 GTGCACCTGCTCTTGTGCCCTGG + Intronic
1076682039 10:132177966-132177988 GTGCACCTGCTCTTGTGCCCTGG + Intronic
1077281621 11:1748634-1748656 GCGCGCCCGCGGGTGCGCCCCGG - Intronic
1082959573 11:58905791-58905813 GCCCGCGAGCGCGTGCGCCCAGG + Intronic
1084387743 11:68854789-68854811 CCGCGGCTGCGCGGGCGCCCTGG - Intergenic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1104977948 12:132560502-132560524 GCGCGCCTTTGTCTGCGCCCAGG + Intronic
1112415353 13:99200143-99200165 GCGACCCTGCGCTTCTGCCCTGG - Intergenic
1112494682 13:99895610-99895632 GCGAGCCCGCGCTTGGGACCCGG + Exonic
1117424369 14:55580084-55580106 GCGCGCCTGCCCACGCGCTCCGG - Intronic
1121127670 14:91418144-91418166 GCGCGCGTGCGCGTGCAGCCGGG + Intergenic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1124249407 15:28097165-28097187 GCGCGCCTGTGCTCTCGGCCCGG - Intronic
1124332422 15:28832151-28832173 TGGCGCCTGCGGTTGCCCCCTGG + Intergenic
1127606539 15:60592608-60592630 GCGCCCCTCCGCTTCCTCCCGGG + Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132802277 16:1760289-1760311 GGGCGCCTGCACTTCCGCCCTGG - Intronic
1133076159 16:3282866-3282888 TCGCGACTGCGCGTGCGCCCTGG - Intronic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1139446296 16:67000742-67000764 ACGCGCCGGCGCGCGCGCCCGGG + Exonic
1143116643 17:4585017-4585039 GAGCGCGTGCGCTGGCGCCAGGG + Intronic
1143155370 17:4833254-4833276 GCTCGCCTGCGCCTGCGCGCAGG + Intergenic
1143174618 17:4948985-4949007 CCGCGCCTGCGCCTGCGCCGGGG + Exonic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1148198028 17:45728807-45728829 GGGCGCCTGCACTTGTGGCCTGG + Intergenic
1150562142 17:66303085-66303107 GCGCTCCGGCGCGTCCGCCCCGG + Intronic
1153480567 18:5543332-5543354 GCCCGCCCGCGCCTGCACCCGGG + Intronic
1160242107 18:77131991-77132013 GCGCTCCTGCCCCTGCCCCCGGG - Intronic
1161824252 19:6551796-6551818 CCGGGCCTGGGCTGGCGCCCAGG + Intergenic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1165349401 19:35268143-35268165 GCCCGCCTGCGTGCGCGCCCCGG + Intergenic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1167129185 19:47573165-47573187 GCCGGGCTGCGCGTGCGCCCCGG - Intergenic
1167517052 19:49929546-49929568 GCGCGGCTGCGCATGCGCACTGG + Intronic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
1168718995 19:58544689-58544711 GCGCGTCTGCGCCTGCGCGGCGG + Exonic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
927945840 2:27134663-27134685 GCGCTCCTGCGCCTGCGCGGAGG - Exonic
931710811 2:64988528-64988550 GCGCTCCTGGGCTTGTGTCCTGG - Intronic
938368794 2:130756147-130756169 GCGGGCCGGCGCTGGCGCGCAGG - Intronic
941804250 2:169694496-169694518 AGGCGCCTGCGCTTGCGAGCTGG + Exonic
941906185 2:170717150-170717172 GCGCACCTGCGCTGGCACACGGG + Exonic
942054833 2:172172705-172172727 GCACGGCTGCAGTTGCGCCCGGG - Intergenic
942278142 2:174337136-174337158 GCGCACCTGCGCTGGCACACGGG + Exonic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
946727049 2:222671499-222671521 GCGCGCCAGCCAATGCGCCCGGG + Intergenic
947632293 2:231662116-231662138 GCGCACCGGCGCCTGCGCCCTGG + Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948913721 2:241019484-241019506 GCACGCCTGCCCCTGCCCCCAGG - Intronic
1170226312 20:13995359-13995381 CTGCGCCTGCGCGTGCGCCCTGG + Exonic
1175374413 20:58514671-58514693 GCTCCCCTACGCTTGCGTCCTGG - Exonic
1176278214 20:64286480-64286502 GCGCGCCTGCGCCGGCGCGGTGG + Intronic
1177775588 21:25562414-25562436 GCGCGCCTGCGGGTGCCCCCTGG + Intergenic
1177783043 21:25640005-25640027 GGGCGTCTGACCTTGCGCCCAGG + Intronic
1179925498 21:44531893-44531915 GCACCCCTGCTCTTCCGCCCAGG - Intronic
1180898499 22:19354253-19354275 GCGCCCCTGCACTTCCGCACAGG + Intronic
1181265605 22:21629059-21629081 GCGTGCCTTCGCCTGCGCCGTGG - Exonic
1181514361 22:23402664-23402686 CCGCGCCCGCGCCGGCGCCCAGG - Intergenic
1185285543 22:49998192-49998214 GTGAGCCTGTGCTGGCGCCCGGG - Exonic
1185302520 22:50089976-50089998 CCGCGCCTGGGCATGCGCCTTGG - Intronic
950590463 3:13933012-13933034 GCGCGGCTTCGCTTCCGCTCCGG - Intergenic
951485245 3:23203079-23203101 GCGTGCCTGCGCGCCCGCCCGGG - Intronic
954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG + Exonic
954304659 3:49719230-49719252 GCGCTCCAGCGCCTGCGCCCCGG - Exonic
963346199 3:144099007-144099029 GAGTGCCTGCTCTTGCTCCCTGG + Intergenic
963728379 3:148947016-148947038 GCGCTCCTGGGCATGCGCCGCGG - Intergenic
966355188 3:179071960-179071982 GCGCCCCTGCGCTCGCGGCCAGG - Exonic
966593387 3:181704771-181704793 GCCCGCCTGGGCTTTCTCCCTGG - Intergenic
968084683 3:195869017-195869039 GCGGCCCTGCTCCTGCGCCCTGG + Intronic
969716768 4:8871682-8871704 GCCGGCCCGCGCGTGCGCCCGGG - Exonic
970823858 4:20251709-20251731 GCGCGCGTTCCCGTGCGCCCTGG - Intergenic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
974052968 4:56958281-56958303 GCCCGCCTCAGCTTGCGCGCTGG + Intergenic
979169035 4:117576034-117576056 GAGCGCCAGCGTGTGCGCCCTGG - Intergenic
981008684 4:139902222-139902244 GCGCGCCTGCGTGTGTGTCCAGG - Intronic
985264357 4:188144403-188144425 GCGCCCCTGCGCTCCAGCCCGGG - Intronic
985299202 4:188469589-188469611 GCGCCCCTGCACTTCAGCCCCGG + Intergenic
986391201 5:7289666-7289688 CGGCGCCTGCGGTTGCCCCCTGG + Intergenic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
992690566 5:79236823-79236845 TCGCGCCCCCGCTTGCTCCCGGG - Exonic
995623897 5:114056199-114056221 GCTCGCCCGCGCCCGCGCCCCGG + Intergenic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1002404996 5:179023791-179023813 GCGCAACTGCGCCTGCGCGCCGG - Exonic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG + Intergenic
1011413227 6:87087561-87087583 ACGCGCCTGCACTTGGGACCTGG + Intronic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1016936922 6:149454616-149454638 GGGCGCCTGCCCTGGTGCCCCGG - Intronic
1018244113 6:161805585-161805607 GAGGGCCTGCGCTGGAGCCCTGG - Intronic
1021451077 7:20784618-20784640 GCGCACCTGCGCTGGCACACGGG - Exonic
1022734397 7:33062645-33062667 GAGCGCCAGCGTGTGCGCCCTGG - Exonic
1022741751 7:33129068-33129090 GAGCGCCAGCGTGTGCGCCCTGG - Intergenic
1033365950 7:140672912-140672934 CCCCGCCTGCGCCCGCGCCCTGG + Intronic
1034441026 7:151086265-151086287 GCGCTCCAGCCCTGGCGCCCCGG - Intronic
1034469610 7:151248326-151248348 GCGGGACTGTGCTGGCGCCCTGG - Intronic
1034478785 7:151303922-151303944 GCGCGCCTGCGCGTACGGCACGG + Intergenic
1035171731 7:157021059-157021081 GCGGGCCTGGGCTTGGGCCTGGG + Intergenic
1042718630 8:71803316-71803338 GCCAGCCTGTGCTTGAGCCCAGG + Intergenic
1049714266 8:144082531-144082553 GCGGCTCTGCGCTTGCGCGCCGG + Intergenic
1049844288 8:144792537-144792559 GTGCGCCTGCGCGGGGGCCCTGG - Exonic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1054333332 9:63781653-63781675 CCGCGCCTGCGCCGGCGCTCTGG - Intergenic
1059176768 9:112175256-112175278 GCGCGCCCGCGCCTCCTCCCGGG + Exonic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1059414766 9:114155900-114155922 GCGCGCCCACACTTGCCCCCCGG + Exonic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1061844004 9:133376483-133376505 GGGCGCCTGCGATTGGACCCTGG - Exonic
1062595008 9:137295581-137295603 GGGCTCCGGCCCTTGCGCCCGGG + Intergenic
1203782390 EBV:107926-107948 GAGCGGCGGCGGTTGCGCCCGGG - Intergenic
1185835648 X:3344767-3344789 ACGCGCCTGCCCATTCGCCCGGG + Intronic
1185877510 X:3712931-3712953 GCGGGGCTGCACCTGCGCCCCGG - Intronic
1185894067 X:3843184-3843206 GCGGGGCTGCCCCTGCGCCCTGG - Intronic
1185899185 X:3881608-3881630 GCGGGGCTGCCCCTGCGCCCTGG - Intergenic
1185904302 X:3920037-3920059 GCGGGGCTGCCCCTGCGCCCTGG - Intergenic
1186029984 X:5357368-5357390 GCGCCCCTGCGCTCCAGCCCGGG + Intergenic
1186426316 X:9465937-9465959 GCGAGGCTGCGCTTCCACCCGGG - Intronic
1192436976 X:71148957-71148979 GCCCACCTGCCCTTGCCCCCAGG + Intronic
1199445035 X:147911783-147911805 GCGCGCATGCGCGCGCTCCCAGG + Intergenic
1200746999 Y:6911447-6911469 GCGCGACTGCGCTTCCACCCAGG - Intronic
1200787796 Y:7274600-7274622 GCGGGGCTGCCCTTGCGCCCTGG + Intergenic