ID: 973554383

View in Genome Browser
Species Human (GRCh38)
Location 4:52067478-52067500
Sequence CTGGGTCAGGGGAAAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973554383_973554389 4 Left 973554383 4:52067478-52067500 CCTGTCACTTTCCCCTGACCCAG 0: 1
1: 0
2: 4
3: 25
4: 264
Right 973554389 4:52067505-52067527 CTGTCTACTTCCTCACTTTGAGG 0: 1
1: 0
2: 2
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973554383 Original CRISPR CTGGGTCAGGGGAAAGTGAC AGG (reversed) Intronic
900148181 1:1167301-1167323 ATGGCTCTGGGGAGAGTGACGGG + Intergenic
900594040 1:3472375-3472397 CTGGGTCATGGGGAGGTGAGGGG + Intronic
900659527 1:3775693-3775715 CTGGGTCAGGGGGAGGGGCCTGG - Intronic
901644434 1:10709015-10709037 ATGGGACGGGGGAGAGTGACAGG + Intronic
902234311 1:15047934-15047956 CTGGGTAAGGGGCAAGTAAGTGG - Intronic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
904302262 1:29561899-29561921 CTGGGTCAGAGCACAGTGGCTGG - Intergenic
904606853 1:31702730-31702752 CAGGGTCAGGGGCTGGTGACTGG + Intronic
904702016 1:32363227-32363249 TGGGGTCAGGGGACAGTGGCGGG + Intronic
905943594 1:41883779-41883801 CTGGGACAGGGGTCAGCGACAGG - Intronic
907045450 1:51297554-51297576 CAGGGGCAGGGGAAAGGGAGAGG - Intronic
907358249 1:53894085-53894107 CCGGGTCAGGGGAAGGAGTCAGG - Intronic
908366992 1:63434725-63434747 CTGGTTTAGGGGAAAGGGCCAGG + Intronic
909602368 1:77473930-77473952 TTTGGTGAGGGTAAAGTGACTGG + Intronic
910201579 1:84705763-84705785 CTGGAACAGTGGGAAGTGACAGG - Intergenic
910535754 1:88295697-88295719 CTGCGTCAGGGGAAAGGAGCAGG - Intergenic
910613496 1:89170521-89170543 CCAAGTCAGGGGAAAGTGATTGG - Intronic
915189634 1:154138105-154138127 ATGGTTCAAGGGAGAGTGACAGG - Exonic
915331700 1:155116736-155116758 ATGGGCGAGGGGAAGGTGACAGG - Intergenic
915543352 1:156582443-156582465 CTGGGGCCGGGGAATGGGACTGG + Intronic
915564102 1:156704493-156704515 CTGGGGCAGGGGAGAGTGCCAGG - Intronic
915686086 1:157636255-157636277 CTGGGCCAGGGGTGGGTGACTGG + Intergenic
915906632 1:159882850-159882872 CTGGCTCAGGGGAGAGAGAGTGG - Intronic
916014062 1:160732849-160732871 ATACGTCAGGGGAAAGTGATGGG + Intergenic
918199395 1:182253233-182253255 CTGGTGCAGGGGGAAGTGAGGGG - Intergenic
920373163 1:205492320-205492342 CTGGGTCTGGGGGAAGGGAGGGG - Intergenic
922257938 1:223909579-223909601 TTGGGTGAGGGGAAACTGAGTGG - Intergenic
923089500 1:230729090-230729112 CTGGGTCAGGGGAGAGGGTCAGG - Intergenic
923099458 1:230800839-230800861 ATGGGTCAGGGGAAAAGGAGAGG - Intronic
1062944359 10:1449322-1449344 ATGGGTCACGGGGAAGTGAAGGG - Intronic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1063732775 10:8718379-8718401 CTGAGTCAGGGGGAAGTAAAAGG - Intergenic
1066305531 10:34136831-34136853 TTGGGTCAGGGGACAATTACAGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070815774 10:79322363-79322385 CTGGGTCAGAGGTCAGGGACTGG - Intergenic
1074844881 10:117388981-117389003 CGGGGAAAGGGGAAAGTGAAGGG - Intergenic
1075212610 10:120503689-120503711 CTGGGGAAGGGGAAAGAGACAGG - Intronic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1077103569 11:832621-832643 CTGGGTGAGGAGAAAGAGATGGG + Intergenic
1079709797 11:23666771-23666793 CTGGGGTAGGGGTAAGTGAAAGG - Intergenic
1080383414 11:31796628-31796650 CTGGGTTAGGGGAAAGACAGAGG + Intronic
1080539911 11:33256251-33256273 CTGGGGCAGGGCAAAGGGAGTGG - Intergenic
1080967355 11:37228588-37228610 CTGTTTCAGAGGCAAGTGACAGG - Intergenic
1081158682 11:39727282-39727304 CTGCTTCAGGGGAGAATGACAGG + Intergenic
1081617669 11:44600238-44600260 CTGGGTCTGGGGAAGCTGAGGGG - Intronic
1082774583 11:57235670-57235692 GTGGTTTAGGGGAAAGAGACTGG - Exonic
1083826449 11:65206693-65206715 CTGGGAGAGGGGAGAGTGGCAGG - Intronic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084461857 11:69300626-69300648 GAGGGTCAGGGGGAAGTCACAGG + Intronic
1084500479 11:69531966-69531988 CAGGGTCGGGGGGATGTGACGGG + Intergenic
1084969691 11:72764318-72764340 CTGGGACAGAGGACAGTGGCCGG + Intronic
1085350682 11:75796291-75796313 TTGGGTCAGAGGAAACTGGCTGG - Intronic
1087284402 11:96249056-96249078 CTGAGTCAGGTGAAAGTCATTGG - Intronic
1088005858 11:104939121-104939143 ATGGGGCAGAGGAAAGTGACTGG + Intergenic
1088700587 11:112407818-112407840 CTGTGTCAGGTGAAATAGACAGG - Intergenic
1089178724 11:116566392-116566414 CTGGGTCAGGAGTTAGTCACTGG + Intergenic
1091442214 12:520093-520115 CTGGCTCAGGGAAAAGGGAGTGG + Intronic
1091648840 12:2294485-2294507 CTGGGGCAGTGGAGAGTGAGGGG + Intronic
1092669871 12:10850934-10850956 CAGGGTCGGGGGAATGTGACTGG + Intronic
1092807384 12:12236966-12236988 CTTGGGCAGGGGAGAGGGACTGG - Intronic
1093914589 12:24787506-24787528 ATGGGTCATGGTAAGGTGACAGG + Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100301742 12:93314338-93314360 CTGAGGCATGGGAAAGTTACAGG - Intergenic
1101315401 12:103624349-103624371 CTGGGTCAGGAGAACATCACTGG - Intronic
1101316934 12:103637870-103637892 CTGGTTCAGGGGGAAATGAAAGG + Intronic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102923077 12:116807603-116807625 CTGGGTCAGGGGAGTGCGAGTGG - Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1108094960 13:46891925-46891947 GTGGGCCAGAGGAAAGTGCCAGG - Intronic
1109486993 13:63038266-63038288 CTGGGGCAAGGGAAAGTGACAGG - Intergenic
1109637582 13:65143053-65143075 CTTGGTAAGGGGGAAGTTACAGG + Intergenic
1110350048 13:74496163-74496185 CTGGGTCAGGGGGTGGTGACAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110527633 13:76557543-76557565 CTGTGTCAGGGGAAAAAGGCAGG - Intergenic
1112261798 13:97884256-97884278 CAGACTCAGGGGAAAGTGGCTGG + Intergenic
1112370334 13:98788086-98788108 CTGGATTAGGGGAGAGGGACAGG - Intergenic
1113844242 13:113377002-113377024 CTGGATCAGGGGAAAGATTCTGG - Intergenic
1114342707 14:21761584-21761606 CTGGGGTACCGGAAAGTGACAGG + Intergenic
1114455293 14:22849785-22849807 CTGGGTCAGCGGGAAGGGAAGGG + Intergenic
1114496932 14:23139337-23139359 ATGGATCAGGGAAAAGTGAGTGG + Intronic
1117508309 14:56424233-56424255 CTGGATCAAGGGAAGGTGAGGGG + Intergenic
1119302937 14:73585251-73585273 CTAGGTCAGGGCAAGGTCACAGG + Intergenic
1120734469 14:88037658-88037680 CTGGGTCAGGGTAGCTTGACTGG + Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1122247938 14:100417434-100417456 CTAGGTCATGGGAAAGAGCCTGG - Intronic
1122457412 14:101865103-101865125 CTGGTTCAGGGGAAAGAGCATGG + Intronic
1123800042 15:23809851-23809873 CTGGGTCTCAGGAAAGTGATTGG + Intergenic
1125340005 15:38665860-38665882 CTGGGGTAGGGGAAAGTCAGTGG + Intergenic
1125802750 15:42464709-42464731 GTGGGGCAGGGGATAGAGACAGG + Intronic
1125879715 15:43183577-43183599 CTGGGTCATGAGAAGGTAACTGG - Intronic
1126048193 15:44663667-44663689 CAGGTTCCGGCGAAAGTGACCGG - Intronic
1126485254 15:49173056-49173078 CTAGGTGAGGGGAAAGGGAATGG - Intronic
1126697008 15:51334914-51334936 CTGTGTCAGGCCAGAGTGACTGG - Intronic
1128547966 15:68580004-68580026 ATGGGGCAGTGGAAAGTGCCAGG + Intronic
1132945604 16:2530093-2530115 CTGGGCCAGGGCACAGTGCCAGG + Exonic
1133530350 16:6649517-6649539 CGGACTCAGGGGAAAGTGTCGGG - Intronic
1137731656 16:50694357-50694379 AGGGGTCAGGGGAGGGTGACAGG - Intronic
1138279051 16:55759091-55759113 CTGGGGAAGGGGAAAGAGACGGG - Intergenic
1138289489 16:55834590-55834612 CTGGGGAAGGGGAAAGAGACGGG + Intergenic
1138651975 16:58465806-58465828 CTGGGACACTGGAAACTGACTGG + Intronic
1139540385 16:67610942-67610964 CTGGTTCTGGGGTAAGTGGCAGG - Exonic
1139573831 16:67829208-67829230 CTGGGTGAGGGGAAAGTATGTGG - Intronic
1142002229 16:87670509-87670531 CTGGGCCTGGGGAGAGGGACAGG - Intronic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1143321356 17:6070833-6070855 CCGGGGCAGGGGAGAGTGAGCGG + Intronic
1143627826 17:8121365-8121387 TTGGGGCAGGGAAAAGGGACAGG + Exonic
1143861835 17:9896989-9897011 CTGGGCCAGGGGAAAGGCAATGG - Exonic
1145355819 17:22148661-22148683 CTGGGGCAAGGGAAAGTGACAGG + Intergenic
1146261665 17:31425995-31426017 CTGGGTCAGTGGAATGTGTCTGG + Intronic
1146491579 17:33287292-33287314 ATGGTTCAGGGGAGAGTGCCAGG - Intronic
1147429019 17:40360274-40360296 CTGAGCCAGAGGAAGGTGACCGG + Intergenic
1148571021 17:48669157-48669179 CTGGGGCACAGGAGAGTGACAGG + Intergenic
1148757460 17:49981077-49981099 CTGGGCTTGGGGAATGTGACAGG - Intergenic
1149542231 17:57476318-57476340 CAGGCTCAGGGGAAGGTGCCAGG - Intronic
1150138144 17:62707040-62707062 CTGGGTCTGGGGTGAGGGACAGG - Intronic
1151146016 17:72041996-72042018 CAGAGTCATGGGAAAGTTACAGG - Intergenic
1152494607 17:80662193-80662215 CTCGGCCAGGAGAAACTGACTGG - Intronic
1152762135 17:82114336-82114358 CTGGGTGAGGGGGGAGGGACGGG + Intronic
1154055187 18:11006055-11006077 CTGAGCCAAGGGAAAGAGACAGG - Intronic
1154070019 18:11145933-11145955 CTAGGGCAGGGGAAAGCAACAGG + Intronic
1156623759 18:38884141-38884163 CTGGGTCAGGGGACAGAAAGGGG - Intergenic
1159689528 18:71468735-71468757 CTGGGTCAGGGAGAAGGGATGGG + Intergenic
1160357274 18:78239023-78239045 CTGCGTCAGGGGCAGGTGCCAGG - Intergenic
1160522106 18:79513679-79513701 CTGGGTCAGAGGGAGGAGACCGG - Intronic
1161331761 19:3691965-3691987 CTGGGGCAGGGAAAAGAGCCTGG - Intronic
1162032748 19:7924586-7924608 GGGGGTCAGGGGCAAGTGGCAGG + Exonic
1162367272 19:10257098-10257120 GTGGGTCAGGAGAGGGTGACAGG - Intronic
1162720156 19:12657363-12657385 CTGGGAAAGGGGACAGAGACAGG - Intronic
1163866040 19:19774280-19774302 CAGGGCCAGTGGACAGTGACTGG + Intergenic
1165495394 19:36149744-36149766 CTGGGTGAGGGCAAAGGGGCTGG + Intronic
1166300045 19:41908081-41908103 CTGGGGCTGGGGAAGGAGACTGG + Intronic
1166846301 19:45730731-45730753 CTGGGTGAGGGGAGATTGCCTGG - Intronic
1166853522 19:45771321-45771343 CTGAGGCAGGGGAAAGAGAGGGG + Intronic
1167290950 19:48624899-48624921 CTGGGCCTGGGGAATGTGAGGGG + Intronic
1167475368 19:49697497-49697519 CTGGGTGAAGGGAGAGTGATTGG - Intronic
925067212 2:937793-937815 CTGAGTCAGGAGAGAGTCACGGG + Intergenic
925819267 2:7783550-7783572 CTGGATGAGGGGAAAGAGACAGG + Intergenic
926591024 2:14740505-14740527 CTGGCACAGTTGAAAGTGACTGG - Intergenic
927393988 2:22628397-22628419 CATGGACAGGGGAATGTGACTGG - Intergenic
928241162 2:29587872-29587894 CTGGTTCAGGGGAAAGAGGTGGG + Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
929576656 2:43056578-43056600 CTTGGTAAGGGGAGAGTGGCTGG + Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932233597 2:70102949-70102971 AGGAGTCAGGGGAAAGTGACTGG + Intergenic
932704079 2:74009968-74009990 CTGGCTCAGGGACAAGTGGCAGG - Intronic
934847219 2:97669608-97669630 CTGTGTCTGTGGACAGTGACGGG - Intergenic
935236805 2:101145643-101145665 CTGGGGGAGGTGAAACTGACAGG - Intronic
935656974 2:105431547-105431569 CTGGGTCAGGGCAGTGTGACTGG + Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
941639320 2:167970158-167970180 CTGGGTAACGAGAGAGTGACGGG - Intronic
941794103 2:169581357-169581379 TTGTGTCAGTGGAAAGTGAGCGG - Intergenic
942428127 2:175880692-175880714 CTGAATCAGGGGAGAGTGATGGG + Intergenic
944822408 2:203443977-203443999 CTGGGTGACGGGAAAGGGAGAGG + Exonic
945768714 2:214013489-214013511 CTGGGGGAGGGAAAAGAGACGGG - Intronic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
946201028 2:218070882-218070904 CTGGGTCTGGGGAGAGGGATGGG - Intronic
946397385 2:219449763-219449785 ATGGGTCAGGGGATGGTGCCCGG - Intronic
946473233 2:219982422-219982444 CTTGGTCACTGGAAAGTGTCAGG - Intergenic
947186894 2:227463543-227463565 CTGGTTCAGGGGAAAGAAAGAGG - Intergenic
1168773860 20:432741-432763 CAGGGGCAGGGGAAGGTGAGTGG + Intergenic
1170330811 20:15208765-15208787 CTGGGTCAGTGGAAGCTAACTGG - Intronic
1170750188 20:19138442-19138464 CTGGGTCAGGGGAAATGTAGAGG + Intergenic
1171409450 20:24936246-24936268 CTGGAGCAGGGCAATGTGACTGG - Intergenic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1174335977 20:49861066-49861088 CTGGGGCAAGGAAAAGTGAATGG + Intronic
1174360045 20:50023300-50023322 CTGGGGCAGGGGAAAGTGTCAGG - Intergenic
1174830169 20:53805140-53805162 ATGGATCAGAGGAAAGGGACAGG - Intergenic
1179476550 21:41650229-41650251 CAGGGTCAGTGGACAGTGAATGG - Intergenic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180285661 22:10742214-10742236 CTGGGACCGGGGCAGGTGACCGG + Intergenic
1180825921 22:18861384-18861406 CTGGGTTAGAAGAAAGTCACAGG - Intergenic
1181186813 22:21113167-21113189 CTGGGTTAGAAGAAAGTCACAGG + Intergenic
1181212389 22:21297329-21297351 CTGGGTTAGAAGAAAGTCACAGG - Intergenic
1181469114 22:23127172-23127194 CTGGCTCAGGGGACAGTGCCAGG + Intronic
1182056370 22:27358478-27358500 CTGGGTCAGTGGGAATTGAGTGG - Intergenic
1182517204 22:30865679-30865701 TTGCGTCAGTGGAAGGTGACCGG + Intronic
1182945720 22:34319691-34319713 GTGGTTCAGGGGAGAGTAACTGG + Intergenic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1184169989 22:42753008-42753030 CTGGGTCCTGGGAGGGTGACAGG - Intergenic
1184698379 22:46151727-46151749 CTGGGTCAGGGCAAGGACACGGG + Intronic
1185298744 22:50068052-50068074 CTGGGTCAGCTCAAAGTAACAGG + Intronic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
1203276063 22_KI270734v1_random:87291-87313 CTGGGTTAGAAGAAAGTCACAGG - Intergenic
949421536 3:3871644-3871666 CTGGGTCAGGGGAAAGAGCTGGG - Intronic
949663868 3:6314004-6314026 CTGGATCCAGAGAAAGTGACTGG - Intergenic
949791617 3:7798665-7798687 CTGTTTCAGGGGAACGTGAGAGG + Intergenic
950171041 3:10839320-10839342 CTGGGTCAGGGGCAGATGAGAGG - Intronic
950454891 3:13086795-13086817 CTGGGTGAGGAGACAGTGCCTGG - Intergenic
950502325 3:13372370-13372392 CAGGGGCAGTGGAAAGAGACGGG + Intronic
952490946 3:33872013-33872035 CTGGGTCAAGGGACAGGGGCAGG - Intergenic
952748489 3:36804347-36804369 CTGGGCCAGGGGCAATTGAAGGG - Intergenic
953524155 3:43673802-43673824 CTGGGGCTGGGGAACATGACTGG + Intronic
954274768 3:49535037-49535059 CTGGGGCAGGGGAGAGGGGCTGG - Exonic
955417372 3:58705175-58705197 CTGGGTCATGAGAGAGTGAATGG - Intergenic
957136614 3:76296507-76296529 CTGGGTCTGGGGAGAGGCACAGG - Intronic
957271123 3:78031316-78031338 CTGCTTCAAGGGAAAGTGTCGGG - Intergenic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
960513702 3:118579887-118579909 CTGGGACACTGGAAAGTCACTGG + Intergenic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
962249149 3:133824399-133824421 ATGGGTGAGGGGAAAGTGAGGGG + Exonic
962847067 3:139282205-139282227 CTGGCTCATGAGAAAGTGCCAGG + Intronic
964310306 3:155385236-155385258 CTGTTTCAGGGGAAAGTCAATGG - Intronic
965520798 3:169666657-169666679 CTGGGACAGGTGGAAGTGACAGG - Intergenic
966882198 3:184356917-184356939 GTAGGTCAGGGGACAGTGATGGG - Intronic
967292596 3:187935884-187935906 TGGGATCAGGGGAAAGTGAGAGG + Intergenic
967298064 3:187985020-187985042 CTGGGGTAGGGGATAGGGACAGG - Intergenic
967894239 3:194383826-194383848 CTGGGGGAGGGCAAAGGGACAGG + Intergenic
968090306 3:195895108-195895130 CTGGGCCAGGGGACAGAGAGCGG - Intronic
968234282 3:197022620-197022642 CGGGGTCAGGGGAGTGTGTCTGG - Intronic
968585037 4:1412372-1412394 CTGGGACAGGGAAGAGTGAAGGG + Intergenic
970343452 4:15130632-15130654 CTGGGTGATGGGGAAGTCACTGG - Intergenic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
973554383 4:52067478-52067500 CTGGGTCAGGGGAAAGTGACAGG - Intronic
976138438 4:81963859-81963881 GCAGGTCAGGGGAGAGTGACAGG + Intronic
977227254 4:94407316-94407338 ATGGATTCGGGGAAAGTGACAGG - Intergenic
979289927 4:118968241-118968263 CAGGGTCAGGAGAATGTCACTGG + Intronic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
981636446 4:146886331-146886353 CTGAGTCAGTGGGAAGAGACAGG - Intronic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
985769193 5:1798515-1798537 AGGAGTCAGGGGAAAGTGACTGG - Exonic
986069196 5:4265548-4265570 CTGGGTCAGGAAACAGAGACTGG + Intergenic
986316777 5:6594500-6594522 CATGGTCAGGAGAAAGTTACTGG - Intergenic
986435767 5:7728821-7728843 CTGGGGATGGGGAGAGTGACTGG + Intronic
987419152 5:17698005-17698027 CTGGATCATGGGAATGTGAAAGG - Intergenic
989301954 5:39905044-39905066 CTGGGACAGAGGAAACAGACAGG + Intergenic
990319159 5:54612791-54612813 CTGACTCAGGAGACAGTGACAGG + Intergenic
992695503 5:79282289-79282311 GTGGCTTAGGGGAAATTGACAGG + Intronic
993532110 5:89037625-89037647 CTGGGTCAAGCGTAAGTGTCTGG + Intergenic
997723925 5:136104654-136104676 CCGGGGAAGGGGGAAGTGACAGG - Intergenic
1000260827 5:159586976-159586998 ATGGGTCTGGGGCAGGTGACTGG - Intergenic
1000399078 5:160806292-160806314 CTGGGTCAGGGGAGTGTAATTGG - Intronic
1001174898 5:169459022-169459044 CTGGGTCAAGGAAAAGAGAAAGG + Intergenic
1001933910 5:175691377-175691399 ATGGGTCTGGGGATGGTGACTGG + Intergenic
1003165129 6:3670884-3670906 CTGGGCCAGGAGAAAGGAACAGG + Intergenic
1006079420 6:31556674-31556696 CTAGGGCAGGGGAAAGGGAGTGG - Intronic
1006365783 6:33614373-33614395 CTGGGGCCGGGGAAGGGGACTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006436800 6:34029913-34029935 CTGGTTCAGGGAAATGTCACAGG + Intronic
1007713478 6:43839249-43839271 CTGGGAACGGGGCAAGTGACTGG + Intergenic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1015214415 6:130733457-130733479 ACAGGTCAGGGGAAAGAGACTGG + Intergenic
1015503049 6:133953066-133953088 CGGGGGACGGGGAAAGTGACGGG + Intronic
1016290810 6:142526542-142526564 CTGGGTAAGCCCAAAGTGACTGG + Intergenic
1019070313 6:169340344-169340366 TTGGGTGAGAGGAAAGTGCCTGG + Intergenic
1019743016 7:2684487-2684509 CTGGGTCAGAGGATGGTGATGGG + Intronic
1019858012 7:3628686-3628708 CTGGGTCAAGATAAAGTAACTGG + Intronic
1021693846 7:23256934-23256956 CATGGTCAGAGGACAGTGACGGG + Exonic
1021911099 7:25386573-25386595 CTGAGAGAGGGGAGAGTGACTGG + Intergenic
1023980639 7:45068073-45068095 CTGAGGCATGGGAAAGTGAAAGG - Intronic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026787754 7:73312741-73312763 TTGGCTGAGGGGAAAGGGACTGG + Exonic
1027675381 7:81151160-81151182 CTTGGGCAGGGGAATCTGACTGG + Intergenic
1029284409 7:99455995-99456017 TTGGCTCAGAGGTAAGTGACTGG + Intronic
1029286374 7:99468691-99468713 CTGGGGCAGGGGAAGCTGAGGGG + Intergenic
1029439095 7:100577511-100577533 CTGGGGCAGGGGACAGGGAGAGG - Exonic
1030354618 7:108528194-108528216 CTGGGTCAGAGGTTAGTTACAGG - Intronic
1032296341 7:130642403-130642425 CTGGGTTAGAGGAAATTGATTGG - Intronic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1033536062 7:142313082-142313104 CTGGGTCTGGGGAAACTATCAGG + Intergenic
1033539726 7:142345401-142345423 CTGGGTCTGGGGAAACTGTCAGG + Intergenic
1036202961 8:6784574-6784596 CTGGGAGAGGGGGCAGTGACTGG - Intergenic
1037053684 8:14408677-14408699 CTAGATGAGGGGAAAGTGGCAGG - Intronic
1037825889 8:22160288-22160310 CTGGGGCAGGGGACAGGAACTGG + Intronic
1038105591 8:24430330-24430352 GTGGGTTTGGGGAAAGTGATGGG + Intergenic
1038336339 8:26648753-26648775 CTGGGACAGGGCAAAGTCCCAGG - Intronic
1039721499 8:40169308-40169330 TGGGGTCAGGGGAAAGTGGGAGG + Intergenic
1040571993 8:48619577-48619599 CTGGGGTAGCTGAAAGTGACTGG - Intergenic
1047304406 8:123641233-123641255 GTGGGTCAGGGGAAAGAAAGAGG + Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1049157625 8:141076466-141076488 CTGGGACAGGGGAAGGTAAATGG + Intergenic
1049604517 8:143523050-143523072 CAGGGTCAGGGGCTAGTGACGGG + Intronic
1052690967 9:31816580-31816602 ATGGATCAGGGGCAAGTAACAGG - Intergenic
1053409668 9:37907392-37907414 CTGGGGCAGGGGAATGGGGCCGG - Intronic
1057304813 9:93905866-93905888 CTGAGTCTGGGGACAGTGAGAGG - Intergenic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1058764341 9:108166709-108166731 ATGGTTCAGGGGAAAGAGAATGG - Intergenic
1059583140 9:115574119-115574141 CTGGGTATGTGGAAAGTTACAGG + Intergenic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060408215 9:123383072-123383094 CTGGGCCAGGAGAAAGGGACTGG - Intronic
1061794947 9:133081128-133081150 CTGGGGCAGGGGAGAGGGAAAGG - Intronic
1062594624 9:137293608-137293630 CTGGGGCAGGAGGAATTGACTGG + Intergenic
1186518460 X:10185134-10185156 CTGGCTAAGGGAAAAGTCACGGG + Exonic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1187694726 X:21907872-21907894 CTGAGACAGGTGAATGTGACAGG + Intergenic
1187795003 X:22994265-22994287 TTGGGTCAGGGGAAAGGAAAAGG - Intergenic
1189145458 X:38650612-38650634 CAGTGTCAGCTGAAAGTGACTGG - Intronic
1195755780 X:108197344-108197366 CTGGGTCCAGGGAAAATGTCTGG + Intronic
1199571738 X:149273399-149273421 CTGGGTCAGGGAAAAGGCCCAGG - Intergenic