ID: 973554900

View in Genome Browser
Species Human (GRCh38)
Location 4:52073058-52073080
Sequence GAATGGGGGCTCTCATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973554900_973554907 13 Left 973554900 4:52073058-52073080 CCAGGCTATGAGAGCCCCCATTC 0: 1
1: 0
2: 0
3: 14
4: 112
Right 973554907 4:52073094-52073116 GTCACCACAGTCTTTAATTTTGG 0: 1
1: 0
2: 1
3: 8
4: 158
973554900_973554909 15 Left 973554900 4:52073058-52073080 CCAGGCTATGAGAGCCCCCATTC 0: 1
1: 0
2: 0
3: 14
4: 112
Right 973554909 4:52073096-52073118 CACCACAGTCTTTAATTTTGGGG 0: 1
1: 0
2: 1
3: 27
4: 277
973554900_973554908 14 Left 973554900 4:52073058-52073080 CCAGGCTATGAGAGCCCCCATTC 0: 1
1: 0
2: 0
3: 14
4: 112
Right 973554908 4:52073095-52073117 TCACCACAGTCTTTAATTTTGGG 0: 1
1: 0
2: 0
3: 28
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973554900 Original CRISPR GAATGGGGGCTCTCATAGCC TGG (reversed) Intronic
900252692 1:1679363-1679385 GAATGGGGGTCCTCATTGCGGGG - Intronic
900564791 1:3326948-3326970 GTCTGGGGGCCCTCACAGCCAGG - Intronic
900707470 1:4089634-4089656 GGATGGGGACTCTCAGGGCCTGG + Intergenic
915380334 1:155434147-155434169 AAGTGAGGGCTCCCATAGCCTGG - Intronic
922203306 1:223425117-223425139 AAATGTGGGCTCTCTTAGCAGGG + Intergenic
922470006 1:225870623-225870645 CAATGGACGCTCTCATAGGCAGG - Intronic
922727367 1:227928659-227928681 GGATGGGCGATCTCAGAGCCTGG + Intronic
924586338 1:245364275-245364297 GAAGAGGGGCCCTCAGAGCCAGG + Intronic
1065176803 10:23085011-23085033 GAATGGTGGTTATCAGAGCCAGG + Intergenic
1069397953 10:68010284-68010306 CAATGAGGGCTCCCATAGCCTGG + Intronic
1069444381 10:68459573-68459595 GAATGGGGGTTGTCAGAGGCTGG + Intronic
1070405110 10:76087540-76087562 GATTGGGGTCCCTCAAAGCCAGG + Intronic
1072032814 10:91537576-91537598 GCATGGGAGCTCACATAGCCTGG + Intergenic
1073477479 10:103763750-103763772 GCATGATGGCTCTCATGGCCGGG - Intronic
1073496272 10:103893920-103893942 GAATGGAAGCTGTCATAACCTGG - Intronic
1074965104 10:118483798-118483820 TAATGGGGATTCTCATAGGCAGG + Intergenic
1075723335 10:124599586-124599608 GACTTGGGCCTCCCATAGCCAGG - Intronic
1077469308 11:2749382-2749404 GAATGGGGGATCCCAAGGCCAGG + Intronic
1078092227 11:8271190-8271212 CAGAGGGGGCTCCCATAGCCAGG - Intergenic
1082795336 11:57374814-57374836 GAATGGGTGCTGTCATTGCCAGG - Intergenic
1083014132 11:59435016-59435038 GAATGGTGGCTCTCAGGGGCAGG + Intergenic
1084399970 11:68937797-68937819 GAAAGGGGCCTCCCAGAGCCTGG + Intronic
1084835035 11:71796158-71796180 GCGTGGGGGCTCACATAGCTCGG - Exonic
1086866527 11:91986433-91986455 GAGTGGGGGCCCTCATTTCCTGG - Intergenic
1088425445 11:109696736-109696758 GAATGGGTGCTCTGACTGCCTGG - Intergenic
1091723037 12:2827124-2827146 GAACGGGGGCTCTTGAAGCCAGG - Exonic
1091970956 12:4786634-4786656 GAATGGGGGTTGTAATAGTCAGG + Intronic
1092396723 12:8133865-8133887 AAGTGAGGGCTCCCATAGCCTGG + Intronic
1093734608 12:22606362-22606384 GAATGGTGGCTATCAAAGGCTGG + Intergenic
1103294699 12:119876463-119876485 CAGTGGGGGCACACATAGCCTGG + Intronic
1106695561 13:32169056-32169078 CAATGGGGGCTCCCATACCCAGG - Intronic
1107599808 13:42001970-42001992 TATTGGGGACTGTCATAGCCTGG - Intergenic
1108053112 13:46464388-46464410 CGATGGGGGCCCTCAGAGCCAGG - Intergenic
1110068079 13:71134226-71134248 GAATGGTGGCTCTCATGGACTGG + Intergenic
1110742970 13:79019011-79019033 GAATGGGTGCTCTGAATGCCTGG + Intergenic
1112223331 13:97513621-97513643 GAATGGGTGCTCTGAATGCCTGG + Intergenic
1113703381 13:112406264-112406286 GAATGGTGGCTGCCAGAGCCTGG - Intronic
1114292207 14:21297521-21297543 GAATGGGAGTTCTCAAAGTCTGG + Intronic
1115313178 14:31999947-31999969 GAATGGTGGCTATCAGAGGCTGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1122352518 14:101104233-101104255 GAATCAGGGCTTTCAAAGCCTGG + Intergenic
1124357907 15:29011023-29011045 GAATGGTGGCTCCCAGAGGCTGG - Intronic
1128419977 15:67482797-67482819 TAATGGGGAATCTGATAGCCAGG + Intronic
1132341349 15:101080192-101080214 GAAAGAGGGGTCTCATGGCCAGG - Intergenic
1133814859 16:9189157-9189179 GAATGGGGGCTTTCTTGGCTGGG + Intergenic
1135637066 16:24086579-24086601 GGATGGGGTCTCTGAAAGCCAGG + Intronic
1137499020 16:48996298-48996320 GAATGTGTGCTCTCTCAGCCTGG + Intergenic
1140188980 16:72798241-72798263 GAGTGGGGTCTCCCATTGCCAGG + Exonic
1143646378 17:8232848-8232870 GGATGGTGGTTCTCATAGCCAGG - Intronic
1154383250 18:13871162-13871184 GGAAGGGGGCTCCCAGAGCCAGG + Intergenic
1155676887 18:28440627-28440649 GAATGGGTGCTCTGAATGCCTGG + Intergenic
1155676937 18:28440946-28440968 GAATGGGTGCTCTGAATGCCAGG + Intergenic
1155993202 18:32302681-32302703 GAATGGTGGCTGTCAGAGGCTGG + Intronic
1164894391 19:31859137-31859159 GAATGGGGCCTTCCACAGCCTGG + Intergenic
1166270946 19:41713591-41713613 GAATGGTGGTTGTCAAAGCCTGG - Intronic
1166858580 19:45796027-45796049 GAATGGGGGCTGGCAGGGCCGGG + Exonic
1168346567 19:55652854-55652876 GGTTGGGGGCTCCCTTAGCCGGG + Exonic
929048782 2:37816547-37816569 GAAGGGGGGCCCTCATGGCAGGG - Intergenic
930849994 2:55950495-55950517 GAAGGGAGACACTCATAGCCTGG + Intergenic
931836196 2:66100418-66100440 GATTGGTGGCTCTCAAAGCATGG - Intergenic
933237022 2:79875240-79875262 GAATGGGGGCTGTCATCCCGGGG - Intronic
933992576 2:87644029-87644051 GATTGGGGCCTCTCATACCTGGG - Intergenic
935678214 2:105614303-105614325 GAATGGTGGCTCCCAGGGCCTGG + Intergenic
936301277 2:111306812-111306834 GATTGGGGCCTCTCATACCTGGG + Intergenic
936509937 2:113137225-113137247 GAAAGGGGGCTTACATGGCCAGG + Intergenic
937823132 2:126334587-126334609 GAATGGGTGCTCTGAATGCCTGG - Intergenic
938260278 2:129890987-129891009 GAATGGGGGCTCACAGATCATGG - Intergenic
939321617 2:140630071-140630093 GAATGGTGGTTCTTATAGCGTGG + Intronic
941154222 2:161955743-161955765 GTATGAGAGCTCTTATAGCCTGG - Intronic
941269681 2:163409542-163409564 GAATTGGGACTCTCCTGGCCTGG + Intergenic
947260560 2:228217464-228217486 GAATCTTGCCTCTCATAGCCAGG + Intergenic
1170154924 20:13260856-13260878 GCAGGGTGGCTCTCATAGCCTGG + Intronic
1171023565 20:21608502-21608524 CAATGGGAGCTCTCAGAGCCGGG + Intergenic
1172191754 20:33065926-33065948 GGATGGGGGTAGTCATAGCCAGG + Intronic
1172600351 20:36178718-36178740 CAAGGGGGGCTCTCATGGCCTGG - Intronic
1173163713 20:40671406-40671428 GAGTGGGGGCTTCCAGAGCCTGG - Intergenic
1173672684 20:44809669-44809691 AAATGGGGGCGCTCAAGGCCTGG + Intronic
1180048880 21:45322319-45322341 GAAGTGTGGCTCTCAGAGCCAGG - Intergenic
1182142714 22:27975603-27975625 GAATGAGGGCTCTCACACGCGGG - Intergenic
956000803 3:64728136-64728158 GAATGGAGGCTCTGAGAGGCTGG + Intergenic
957371814 3:79303792-79303814 GAATGGTGGTTCTCAGAGGCTGG - Intronic
959542678 3:107558191-107558213 GAAAGGGGGCTATCTTGGCCGGG + Intronic
961093572 3:124136403-124136425 GATCAGGGGCTCTCATAGCAAGG - Intronic
961301514 3:125925107-125925129 GCATGGGGGCTCACCTAGCTCGG - Intergenic
961691709 3:128674737-128674759 AAGTGGGGGCTCCCATAGCCTGG + Intronic
965032521 3:163391331-163391353 GGATGGGGACTCACACAGCCTGG + Intergenic
965813479 3:172614606-172614628 GACTGGGTGCTTTCACAGCCTGG - Intergenic
967449134 3:189603072-189603094 GAATGGAGGCTCTTTTACCCAGG + Intergenic
973554900 4:52073058-52073080 GAATGGGGGCTCTCATAGCCTGG - Intronic
985865184 5:2509000-2509022 GGATGGAGGCTGGCATAGCCTGG + Intergenic
998423618 5:142009327-142009349 GCAGGGAGGGTCTCATAGCCAGG - Intronic
1000758734 5:165194436-165194458 GAATGGGTGCCCTAATAGACTGG + Intergenic
1005017302 6:21386374-21386396 GAATGGGGGTTGCCAGAGCCTGG + Intergenic
1005782161 6:29203147-29203169 ATATGGGGTCTCTCATAGCTAGG + Intergenic
1006028868 6:31164695-31164717 AAGTGAGGGCTCCCATAGCCTGG + Exonic
1006950484 6:37818648-37818670 GAAGTGCGGCTCTCCTAGCCTGG + Intergenic
1009620912 6:66075861-66075883 GAATGGTTGCTCTCAAAGGCTGG - Intergenic
1013904378 6:115198254-115198276 CAATGGCTGCTCTCATGGCCTGG + Intergenic
1017773076 6:157658201-157658223 GAATGGGAGCTCTCATTCCCTGG - Intronic
1018163968 6:161076345-161076367 GAATGGGAGCTCTCTTAGCAGGG + Intronic
1031968010 7:128042056-128042078 GAATGAGAGCTCTTCTAGCCAGG - Intronic
1032079765 7:128853038-128853060 GAATGGGGGCTCTCTGGGGCAGG - Intronic
1032477477 7:132222278-132222300 GCATGGGGGCTCCCATAGCACGG - Intronic
1036073513 8:5468954-5468976 GAATGGTGGCTATTATAGGCAGG + Intergenic
1036611965 8:10358222-10358244 GAGTGGTGGCTCACATCGCCAGG - Intronic
1036932840 8:12973001-12973023 GAATGGTGGCTCCCAGGGCCTGG - Intronic
1037818954 8:22126464-22126486 GAATGGCTGCTCTCTTGGCCAGG - Intronic
1038153966 8:24969864-24969886 GAATGGTGGCTATCAGAGGCTGG - Intergenic
1042109686 8:65367512-65367534 GAATGGGTGCTCTGACTGCCTGG - Intergenic
1044604139 8:94034219-94034241 GAATGGGGGATCCCAAAGCCAGG - Intergenic
1045727065 8:105186277-105186299 GAATGGGTGCTCTAAATGCCTGG + Intronic
1045945311 8:107788858-107788880 GTATGGGGGCTCTTGTGGCCAGG + Intergenic
1046058487 8:109107570-109107592 GAATGTTGGAACTCATAGCCAGG + Intronic
1047125850 8:121959752-121959774 GAATGGGGCCTTTCTTAGCATGG - Intergenic
1047697414 8:127416830-127416852 AAGTGAGGGCTCCCATAGCCTGG - Exonic
1051565275 9:18490247-18490269 GAATGGGGGCTCTAGCAGACAGG + Intronic
1056969766 9:91192226-91192248 TAATGGGGGCTGGCAGAGCCTGG + Intergenic
1057267600 9:93629624-93629646 GAAGAGGGGTTCTCAGAGCCAGG - Intronic
1061969936 9:134039520-134039542 GGATGGGAGCTCTCCTGGCCAGG - Intronic
1062367272 9:136216838-136216860 GGATGGGGCCTCTCATAACTCGG + Intronic
1186422287 X:9435868-9435890 GCCTGGGGGCTCTCAGAGCAGGG - Intergenic
1189572674 X:42315697-42315719 GAATGGGTGCACTAAAAGCCTGG - Intergenic
1190623656 X:52314480-52314502 GAGTAGCGGCTCTCAGAGCCTGG - Intergenic
1198137556 X:133769207-133769229 GAATGGTGGTTTTCAGAGCCTGG + Intronic
1199643206 X:149882561-149882583 GAATGGGGGTACTCCTGGCCTGG + Intronic
1200659096 Y:5939849-5939871 GAATGGGGGCTTTCAGATTCAGG + Intergenic
1201247859 Y:12024062-12024084 AAATGTGGACTCTCATAGGCTGG - Intergenic