ID: 973559936

View in Genome Browser
Species Human (GRCh38)
Location 4:52125081-52125103
Sequence TTAAGTTATTCCAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973559932_973559936 5 Left 973559932 4:52125053-52125075 CCTTTGCTTCATATATTTTGTCT No data
Right 973559936 4:52125081-52125103 TTAAGTTATTCCAGGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973559936 Original CRISPR TTAAGTTATTCCAGGAAAGA GGG Intergenic
No off target data available for this crispr