ID: 973559936 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:52125081-52125103 |
| Sequence | TTAAGTTATTCCAGGAAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973559932_973559936 | 5 | Left | 973559932 | 4:52125053-52125075 | CCTTTGCTTCATATATTTTGTCT | No data | ||
| Right | 973559936 | 4:52125081-52125103 | TTAAGTTATTCCAGGAAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973559936 | Original CRISPR | TTAAGTTATTCCAGGAAAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||