ID: 973564527

View in Genome Browser
Species Human (GRCh38)
Location 4:52170843-52170865
Sequence GCAGCCAGGAAGATTGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973564527_973564532 9 Left 973564527 4:52170843-52170865 CCCAATTCAATCTTCCTGGCTGC No data
Right 973564532 4:52170875-52170897 TACTCAAGCGTCAGCAATGGCGG No data
973564527_973564530 6 Left 973564527 4:52170843-52170865 CCCAATTCAATCTTCCTGGCTGC No data
Right 973564530 4:52170872-52170894 ACCTACTCAAGCGTCAGCAATGG 0: 6
1: 1391
2: 1652
3: 1513
4: 1316
973564527_973564533 10 Left 973564527 4:52170843-52170865 CCCAATTCAATCTTCCTGGCTGC No data
Right 973564533 4:52170876-52170898 ACTCAAGCGTCAGCAATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973564527 Original CRISPR GCAGCCAGGAAGATTGAATT GGG (reversed) Intergenic
No off target data available for this crispr