ID: 973567483

View in Genome Browser
Species Human (GRCh38)
Location 4:52202713-52202735
Sequence TGAAAACTCTGTAGTGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973567483_973567485 -5 Left 973567483 4:52202713-52202735 CCTTGACCACTACAGAGTTTTCA No data
Right 973567485 4:52202731-52202753 TTTCAGTTTATTAACACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973567483 Original CRISPR TGAAAACTCTGTAGTGGTCA AGG (reversed) Intergenic
No off target data available for this crispr