ID: 973587917

View in Genome Browser
Species Human (GRCh38)
Location 4:52410837-52410859
Sequence GTGAATATATAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973587917_973587922 25 Left 973587917 4:52410837-52410859 CCATTGTCCATTTATATATTCAC No data
Right 973587922 4:52410885-52410907 GCATCCTCCATCTCACTTGGAGG No data
973587917_973587923 26 Left 973587917 4:52410837-52410859 CCATTGTCCATTTATATATTCAC No data
Right 973587923 4:52410886-52410908 CATCCTCCATCTCACTTGGAGGG No data
973587917_973587921 22 Left 973587917 4:52410837-52410859 CCATTGTCCATTTATATATTCAC No data
Right 973587921 4:52410882-52410904 CCTGCATCCTCCATCTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973587917 Original CRISPR GTGAATATATAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr