ID: 973589009

View in Genome Browser
Species Human (GRCh38)
Location 4:52421254-52421276
Sequence GGCCATCTGGTCTTACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973589009_973589014 22 Left 973589009 4:52421254-52421276 CCTGGAGGTAAGACCAGATGGCC No data
Right 973589014 4:52421299-52421321 TCTATAGATTTTTAAAGGAATGG No data
973589009_973589015 26 Left 973589009 4:52421254-52421276 CCTGGAGGTAAGACCAGATGGCC No data
Right 973589015 4:52421303-52421325 TAGATTTTTAAAGGAATGGAAGG No data
973589009_973589012 17 Left 973589009 4:52421254-52421276 CCTGGAGGTAAGACCAGATGGCC No data
Right 973589012 4:52421294-52421316 TCCTGTCTATAGATTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973589009 Original CRISPR GGCCATCTGGTCTTACCTCC AGG (reversed) Intergenic