ID: 973590653

View in Genome Browser
Species Human (GRCh38)
Location 4:52437368-52437390
Sequence CCTGCCTAGCAGGAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973590647_973590653 3 Left 973590647 4:52437342-52437364 CCTAGTCCTGCAAATGTTGAGGC No data
Right 973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG No data
973590644_973590653 9 Left 973590644 4:52437336-52437358 CCTTGCCCTAGTCCTGCAAATGT No data
Right 973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG No data
973590643_973590653 18 Left 973590643 4:52437327-52437349 CCATTTGTACCTTGCCCTAGTCC No data
Right 973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG No data
973590642_973590653 21 Left 973590642 4:52437324-52437346 CCTCCATTTGTACCTTGCCCTAG No data
Right 973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG No data
973590645_973590653 4 Left 973590645 4:52437341-52437363 CCCTAGTCCTGCAAATGTTGAGG No data
Right 973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG No data
973590648_973590653 -3 Left 973590648 4:52437348-52437370 CCTGCAAATGTTGAGGCGTGCCT No data
Right 973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973590653 Original CRISPR CCTGCCTAGCAGGAGATGGG AGG Intergenic
No off target data available for this crispr