ID: 973602340

View in Genome Browser
Species Human (GRCh38)
Location 4:52554375-52554397
Sequence TGATTCTCTGGACACCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973602340_973602345 -7 Left 973602340 4:52554375-52554397 CCCCGCTGGTGTCCAGAGAATCA No data
Right 973602345 4:52554391-52554413 AGAATCAGAAAATAGGTTATTGG No data
973602340_973602347 19 Left 973602340 4:52554375-52554397 CCCCGCTGGTGTCCAGAGAATCA No data
Right 973602347 4:52554417-52554439 GGAAAACCTCCATACCTTTGAGG No data
973602340_973602346 -2 Left 973602340 4:52554375-52554397 CCCCGCTGGTGTCCAGAGAATCA No data
Right 973602346 4:52554396-52554418 CAGAAAATAGGTTATTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973602340 Original CRISPR TGATTCTCTGGACACCAGCG GGG (reversed) Intergenic