ID: 973603377

View in Genome Browser
Species Human (GRCh38)
Location 4:52563227-52563249
Sequence GATCATTGAATTATTTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973603377_973603381 29 Left 973603377 4:52563227-52563249 CCTGTGGAAATAATTCAATGATC No data
Right 973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG No data
973603377_973603379 24 Left 973603377 4:52563227-52563249 CCTGTGGAAATAATTCAATGATC No data
Right 973603379 4:52563274-52563296 GTAAACCAATTTGAAAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973603377 Original CRISPR GATCATTGAATTATTTCCAC AGG (reversed) Intergenic
No off target data available for this crispr