ID: 973603378

View in Genome Browser
Species Human (GRCh38)
Location 4:52563249-52563271
Sequence TATGCTGTAGAAGTACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973603378_973603383 15 Left 973603378 4:52563249-52563271 CCTTCATGTACTTCTACAGCATA No data
Right 973603383 4:52563287-52563309 AAAGTATTGGCCAGGCATGGTGG No data
973603378_973603379 2 Left 973603378 4:52563249-52563271 CCTTCATGTACTTCTACAGCATA No data
Right 973603379 4:52563274-52563296 GTAAACCAATTTGAAAGTATTGG No data
973603378_973603382 12 Left 973603378 4:52563249-52563271 CCTTCATGTACTTCTACAGCATA No data
Right 973603382 4:52563284-52563306 TTGAAAGTATTGGCCAGGCATGG No data
973603378_973603381 7 Left 973603378 4:52563249-52563271 CCTTCATGTACTTCTACAGCATA No data
Right 973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973603378 Original CRISPR TATGCTGTAGAAGTACATGA AGG (reversed) Intergenic
No off target data available for this crispr