ID: 973603381

View in Genome Browser
Species Human (GRCh38)
Location 4:52563279-52563301
Sequence CCAATTTGAAAGTATTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973603377_973603381 29 Left 973603377 4:52563227-52563249 CCTGTGGAAATAATTCAATGATC No data
Right 973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG No data
973603376_973603381 30 Left 973603376 4:52563226-52563248 CCCTGTGGAAATAATTCAATGAT No data
Right 973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG No data
973603378_973603381 7 Left 973603378 4:52563249-52563271 CCTTCATGTACTTCTACAGCATA No data
Right 973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973603381 Original CRISPR CCAATTTGAAAGTATTGGCC AGG Intergenic
No off target data available for this crispr