ID: 973603614

View in Genome Browser
Species Human (GRCh38)
Location 4:52565443-52565465
Sequence CACTGATGGTGGGAGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973603604_973603614 15 Left 973603604 4:52565405-52565427 CCTCCTGTGATTTTGCCTTTGGT No data
Right 973603614 4:52565443-52565465 CACTGATGGTGGGAGTGGGGTGG No data
973603606_973603614 0 Left 973603606 4:52565420-52565442 CCTTTGGTTGTTCCTTTACTATA No data
Right 973603614 4:52565443-52565465 CACTGATGGTGGGAGTGGGGTGG No data
973603605_973603614 12 Left 973603605 4:52565408-52565430 CCTGTGATTTTGCCTTTGGTTGT No data
Right 973603614 4:52565443-52565465 CACTGATGGTGGGAGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973603614 Original CRISPR CACTGATGGTGGGAGTGGGG TGG Intergenic
No off target data available for this crispr