ID: 973612554

View in Genome Browser
Species Human (GRCh38)
Location 4:52650046-52650068
Sequence CACCTAGCAAAGCTGCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973612551_973612554 13 Left 973612551 4:52650010-52650032 CCAATTGGTGGAACCACTTTGGA 0: 1
1: 0
2: 14
3: 18
4: 101
Right 973612554 4:52650046-52650068 CACCTAGCAAAGCTGCAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 120
973612552_973612554 0 Left 973612552 4:52650023-52650045 CCACTTTGGAGAGCAATTTGACA 0: 1
1: 14
2: 84
3: 435
4: 1661
Right 973612554 4:52650046-52650068 CACCTAGCAAAGCTGCAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973612554 Original CRISPR CACCTAGCAAAGCTGCAGAT GGG Intronic
902188729 1:14745208-14745230 CACATTGCCAGGCTGCAGATCGG - Intronic
902529791 1:17083622-17083644 CACCCAGCAGCTCTGCAGATGGG - Intronic
905930062 1:41780538-41780560 CACCTCCTAAACCTGCAGATTGG + Intronic
909928786 1:81470960-81470982 CAGCTAGCAAAACTGCAGTCAGG - Intronic
912111779 1:106351156-106351178 AACCTAACATAGCTACAGATGGG + Intergenic
912454836 1:109790528-109790550 CAGATAGCAAAGCTGTGGATTGG + Intergenic
913441907 1:118907208-118907230 CATCTAGTACAGCTGCAGGTGGG - Intronic
919762341 1:201106078-201106100 CACTTACCAAGACTGCAGATGGG - Intronic
1063216113 10:3927084-3927106 CACCTGGCAAAGCTGCAGCTGGG + Intergenic
1064300332 10:14117588-14117610 CACCTAGCAATGCTGCCATTTGG - Intronic
1066093262 10:32047409-32047431 CACCTAGCAAAACTCCAAATGGG + Intronic
1068705666 10:60072772-60072794 CACAGAGCAAAGCACCAGATGGG - Exonic
1072510222 10:96115014-96115036 CACCTAGCTAAGCTGCTTCTAGG + Intergenic
1072625789 10:97110755-97110777 AACGTAGCAAAGCTGCAGGAAGG - Intronic
1073350814 10:102818605-102818627 TACCCAGCAAGACTGCAGATGGG + Intergenic
1078371906 11:10754355-10754377 CAACTAGATAAGCAGCAGATTGG + Intronic
1079303257 11:19298278-19298300 GACCCTGCAAAGCTGGAGATGGG + Intergenic
1081322579 11:41709191-41709213 AACCTAGCAAAGCTACTGCTTGG + Intergenic
1081712285 11:45225014-45225036 CACCTGGCAGAGCTGCCGATGGG - Exonic
1082274712 11:50208745-50208767 CAGCTAGCTAAGCAGGAGATAGG - Intergenic
1083150179 11:60787005-60787027 CCCCCAGCAAAGCAGCAGAGTGG - Intronic
1083606732 11:63983236-63983258 CTCCTGGCGAATCTGCAGATGGG + Intronic
1086235596 11:84626436-84626458 CATCTAGCAAATGTGCACATTGG + Intronic
1089178037 11:116562292-116562314 AACCTCCCCAAGCTGCAGATTGG + Intergenic
1089220946 11:116871166-116871188 TAGCTAGCAAGGATGCAGATGGG - Intronic
1090088370 11:123671580-123671602 CTTCTAGGAAAGCTGCGGATGGG - Intergenic
1090476160 11:127022649-127022671 TATCTAGTAAAGCTGTAGATGGG + Intergenic
1095380906 12:41590600-41590622 TACCTAGCATAGCTCCTGATTGG + Intergenic
1096482063 12:51948908-51948930 CACCTAGGAAAGCTCTAGTTTGG + Intergenic
1096748560 12:53744419-53744441 CAGCTATCAGAGCTGCAGATGGG + Intergenic
1099059122 12:77884023-77884045 CACCTATCAAAGCTATAGTTGGG - Intronic
1101419743 12:104540670-104540692 CACCAGGGAAACCTGCAGATGGG + Intronic
1101969789 12:109304947-109304969 CTCCCAGCAAACCTGCAAATTGG + Intronic
1106113458 13:26797216-26797238 CAGCCAGCAAACCAGCAGATGGG - Intergenic
1107997256 13:45873022-45873044 CAACTAGCAAAGCCCCATATGGG - Intergenic
1110439027 13:75507357-75507379 CTCCAAGCAAGGCTGCAGTTGGG + Intergenic
1115630981 14:35245077-35245099 CATCTGGCAAAGCTGTAGTTTGG + Intronic
1117226028 14:53659872-53659894 CAACTAGCAATGTTGTAGATAGG - Intergenic
1121330529 14:93046828-93046850 CACCGAGCAGAGCTTCTGATGGG - Intronic
1126665221 15:51069799-51069821 TAAGTAGCAAAGCTGCAGTTGGG + Intronic
1129470330 15:75750229-75750251 CACCTAGGCAAGCTGGAGAAGGG - Intergenic
1129982592 15:79887849-79887871 CATCTAGCAAAGCCCAAGATTGG + Intronic
1131298045 15:91169494-91169516 CTCCTAGCTCAGCTGCAGTTAGG - Intronic
1131476299 15:92743083-92743105 AACCAAGCAAAGCTCCAGATGGG - Intronic
1132806358 16:1776899-1776921 CACCCAGCACAGCAGCAGAGGGG + Exonic
1140030965 16:71339007-71339029 CACTTAATAAAGCTCCAGATAGG + Intergenic
1143472048 17:7181643-7181665 CAGCTTGCAAAGCTGCAGAAAGG + Intergenic
1144659493 17:17058887-17058909 CCCCAAGCAAAGGTGCAGAAGGG + Intronic
1149776936 17:59365666-59365688 CACTCAGCAAAGCTGCTGAGAGG + Intronic
1150656388 17:67042489-67042511 CACCCAGCAAAGCAGTAGCTGGG - Intergenic
1153786228 18:8537586-8537608 CTCCTTGCAAATCTCCAGATGGG + Intergenic
1154336909 18:13473281-13473303 CAACTAGAGAAGCTGGAGATGGG - Intronic
1155717605 18:28965979-28966001 CATCCAGCAAAGTTGAAGATGGG + Intergenic
1155999487 18:32369193-32369215 CACCTTTCAAAGCAGCATATGGG - Intronic
1157724954 18:49957311-49957333 CCCCCAGCAAAGCTGCTGACAGG + Intronic
1159983014 18:74809037-74809059 CGCATAGTAAAACTGCAGATAGG + Intronic
926357163 2:12051624-12051646 CACCTAGCAGAGCTGCTGTGAGG + Intergenic
928280572 2:29942864-29942886 CACCTAGCCAAGCTGCCTAGTGG + Intergenic
930566712 2:53029704-53029726 CACCTAGCAAAGATGTGCATTGG + Intergenic
937879065 2:126851461-126851483 CATCTGTCAAAGCTGCTGATGGG + Intergenic
938830693 2:135047698-135047720 CCCCTTTCAAAGCTGCATATAGG + Intergenic
940167479 2:150791130-150791152 GACCTAGCTCAGCTGCAGATTGG + Intergenic
940345098 2:152620719-152620741 CGGCTGGCAGAGCTGCAGATGGG - Intronic
942602646 2:177657428-177657450 CACCTTGCAAAGCTACAAGTAGG - Intronic
1174827191 20:53778823-53778845 CACCTGGCAAAGGGGCAAATTGG + Intergenic
1176083649 20:63286179-63286201 CACCTGGCACCGCTGCAGAGTGG + Intronic
1176247207 20:64102936-64102958 CACCTCGCAAAGCAGCAGCACGG - Intergenic
1178783435 21:35628957-35628979 CGAATAGGAAAGCTGCAGATAGG + Intronic
1179720084 21:43311203-43311225 CACCCAGCAGCTCTGCAGATAGG + Intergenic
1180049509 21:45324882-45324904 CGCATAGCCACGCTGCAGATGGG - Intergenic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1184112317 22:42402527-42402549 GACCCAGCAAAGCTGCCTATGGG + Intronic
1184878565 22:47290827-47290849 CACCCAGCACAGCTGCAGCCAGG + Intergenic
954387207 3:50250392-50250414 CACCCAGCTAAGCTGCACAGAGG + Intronic
954453780 3:50586059-50586081 CAGCTACCAGAGCTTCAGATGGG - Intergenic
955879728 3:63530533-63530555 CACTCAGCAAAGTAGCAGATGGG + Intronic
955991131 3:64628547-64628569 CTCCTTGCACAGCTGCAGAATGG - Intronic
958023939 3:88028278-88028300 CCACTAGCAAAGCAGCAGATTGG + Intergenic
961787430 3:129356135-129356157 CTCTTAGGAATGCTGCAGATGGG + Intergenic
963464585 3:145663404-145663426 ATCCTGGCAAAGCTGCAGAGAGG - Intergenic
967039190 3:185673874-185673896 CACCTGGAAAAGCTACAGAAGGG - Intronic
967341210 3:188400307-188400329 CAAATAGCAAAGCTGAAGCTGGG - Intronic
968197288 3:196717935-196717957 CACCTTGCGAAGCTTCAGTTTGG - Intronic
973612554 4:52650046-52650068 CACCTAGCAAAGCTGCAGATGGG + Intronic
975622288 4:76307067-76307089 CCCCTAGGAAAGCTCCAGGTGGG - Intronic
977074449 4:92435136-92435158 CCTCTAGGAAAACTGCAGATGGG - Intronic
977435744 4:96991927-96991949 CAGCTAGCTGAGCTGCAGGTAGG + Intergenic
978259142 4:106732033-106732055 CAACTAGTAAGGTTGCAGATAGG + Intergenic
981107984 4:140903117-140903139 CACCTAACAAAAATGCAGAAAGG + Intronic
982306878 4:153941787-153941809 CACATAAAAAAGCTGCAGAAGGG - Intergenic
983794560 4:171844947-171844969 AGACTAGCAAACCTGCAGATAGG - Intronic
984953597 4:185024246-185024268 CACATAGAAAAGCTCCAGATTGG + Intergenic
994350028 5:98734931-98734953 CACATAGCAGACCTGCTGATGGG + Intergenic
995387927 5:111609002-111609024 CACCTTGCAAAGGTGGTGATAGG - Intergenic
999373722 5:151071900-151071922 CACCTAACTAAGCTGGAGAGAGG + Intronic
1000494081 5:161956462-161956484 CACCCAGAACAGCTGTAGATAGG + Intergenic
1003725938 6:8763983-8764005 TAGCTAGTAAAGCTGAAGATGGG - Intergenic
1008268350 6:49460172-49460194 CACATAGAAACGCTGCAAATTGG - Intronic
1008493421 6:52109032-52109054 CACCCAGCCCTGCTGCAGATTGG - Intergenic
1016327926 6:142923992-142924014 CATTTAGCAAAGCTGAAGAGAGG - Intronic
1017413002 6:154189325-154189347 CATCTAGTAAAGTTGAAGATAGG + Intronic
1017413251 6:154192157-154192179 CATCTAGTAAAGTTGAAGATAGG - Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1020971861 7:14953671-14953693 CACCTAGCAAATCTGCTCTTAGG + Intronic
1022187086 7:27980285-27980307 CACATAGCATTGCAGCAGATTGG + Intronic
1023734820 7:43225352-43225374 CACCTAGCAAAGTGGAGGATGGG + Intronic
1028073505 7:86481492-86481514 CACCCTCCAAAGATGCAGATTGG + Intergenic
1028230882 7:88305540-88305562 CACATAGCAAGGCTGAAGAATGG + Intronic
1030202477 7:106919196-106919218 CAACCTGCAACGCTGCAGATTGG + Intergenic
1032059748 7:128714764-128714786 GACCTAGCAGAGCTGCTCATCGG + Intronic
1036622225 8:10431818-10431840 CACTTAGGAAAGCTGGAGAGCGG - Intergenic
1040350234 8:46559091-46559113 CACCTAGCAAAGTTATACATGGG + Intergenic
1040366815 8:46725953-46725975 CACCTAGCAAAGTTATACATGGG - Intergenic
1043729204 8:83652841-83652863 CAACTATCAATGCTGCTGATTGG - Intergenic
1047505928 8:125480208-125480230 CCACTCACAAAGCTGCAGATGGG + Intergenic
1048262361 8:132955868-132955890 CACCCAGCAATGCTGGAGAATGG + Intronic
1049425097 8:142534410-142534432 CAGCTGGCACAGCTGAAGATGGG + Intronic
1051609168 9:18944711-18944733 CATTTAGCAAAGCTGAAGAAAGG + Intronic
1053196262 9:36121390-36121412 GGCCTAGCAAAGCTGCGGTTGGG + Intronic
1055934040 9:81588645-81588667 CAACTAGCAGAGCTGCTGAGGGG + Intronic
1057754403 9:97820334-97820356 CTCCCAGCAACCCTGCAGATGGG + Intergenic
1059419246 9:114180862-114180884 CACCTTCAGAAGCTGCAGATGGG + Intronic
1060140387 9:121204386-121204408 CACATAGGAAAGCAGCAGTTAGG - Intronic
1060149974 9:121282240-121282262 CACCTAACAAAGCTGCTGTGTGG + Intronic
1189717514 X:43881613-43881635 CAGAGAGCAAAGCTGCAGCTTGG + Intronic
1189916911 X:45864458-45864480 CACCCTGCCAAGTTGCAGATTGG - Intergenic
1190333213 X:49248293-49248315 AACCTTGCCAAGCTGCAGGTGGG + Exonic
1190479480 X:50861696-50861718 CACATACCAAGGCTGCAAATAGG - Intergenic