ID: 973613556

View in Genome Browser
Species Human (GRCh38)
Location 4:52658895-52658917
Sequence CCGTCTCAGCCCCGGGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973613556_973613565 -8 Left 973613556 4:52658895-52658917 CCGAGGTCCCGGGGCTGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 973613565 4:52658910-52658932 TGAGACGGGCGCCGGGGGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 208
973613556_973613570 14 Left 973613556 4:52658895-52658917 CCGAGGTCCCGGGGCTGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 973613570 4:52658932-52658954 GGGACCCTCCCCGGCCGCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 212
973613556_973613576 23 Left 973613556 4:52658895-52658917 CCGAGGTCCCGGGGCTGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 973613576 4:52658941-52658963 CCCGGCCGCTGAGGTGGCTGCGG 0: 1
1: 0
2: 5
3: 298
4: 9987
973613556_973613569 5 Left 973613556 4:52658895-52658917 CCGAGGTCCCGGGGCTGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 973613569 4:52658923-52658945 GGGGGCTCGGGGACCCTCCCCGG 0: 1
1: 0
2: 0
3: 42
4: 339
973613556_973613566 -7 Left 973613556 4:52658895-52658917 CCGAGGTCCCGGGGCTGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 973613566 4:52658911-52658933 GAGACGGGCGCCGGGGGCTCGGG 0: 1
1: 0
2: 1
3: 21
4: 332
973613556_973613567 -6 Left 973613556 4:52658895-52658917 CCGAGGTCCCGGGGCTGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 973613567 4:52658912-52658934 AGACGGGCGCCGGGGGCTCGGGG 0: 1
1: 0
2: 2
3: 9
4: 193
973613556_973613571 17 Left 973613556 4:52658895-52658917 CCGAGGTCCCGGGGCTGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 973613571 4:52658935-52658957 ACCCTCCCCGGCCGCTGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973613556 Original CRISPR CCGTCTCAGCCCCGGGACCT CGG (reversed) Intronic
901835232 1:11919811-11919833 CCGGCCCAGCCTCGGGACCGTGG + Exonic
902819099 1:18932751-18932773 CTGCCTCATCCCCGGGGCCTTGG - Intronic
903349615 1:22710233-22710255 CCGGCCCAGCCCCGGTGCCTGGG + Intergenic
904090612 1:27942379-27942401 CGGTCTCAGCTCAGGGACTTGGG + Intronic
904881300 1:33699037-33699059 CTGTCTCAGCCACGGACCCTGGG + Intronic
906045824 1:42830358-42830380 CCGTCTCGGCCTCGGCTCCTGGG + Intronic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
918431653 1:184467131-184467153 CCCTCTCAGCCCCATGTCCTGGG - Intronic
919532046 1:198734323-198734345 CAGTTTCATCCCTGGGACCTAGG - Exonic
919880089 1:201895424-201895446 CCTTCCCAGCACTGGGACCTAGG - Intergenic
922084592 1:222333920-222333942 ACGTCTAAGCCCAGAGACCTTGG - Intergenic
922326941 1:224536647-224536669 CCATCTCTGCCCCGTCACCTTGG - Intronic
922702828 1:227771755-227771777 CCTGCTCAGCCCAGGGTCCTGGG - Intronic
1063993525 10:11593794-11593816 ACGTCTCAGCCCAGGCAGCTAGG - Intronic
1070581569 10:77724523-77724545 CCTTCTAAGCCTCTGGACCTGGG - Intergenic
1072916463 10:99540292-99540314 CCCCCTCACCCCGGGGACCTGGG - Intergenic
1074715565 10:116215544-116215566 CCTTCTCAGCCCCGTGACAGGGG - Intronic
1077440883 11:2568450-2568472 CTGTCTCAGCTCCGGGGACTTGG + Intronic
1077511116 11:2963660-2963682 CCATCTCAGCACTGGGGCCTGGG - Intronic
1081873007 11:46391705-46391727 CCGTCCCCGCCCCCGGCCCTCGG - Intergenic
1083695922 11:64442337-64442359 CTGCCTCTGCCCTGGGACCTTGG + Intergenic
1084571763 11:69964000-69964022 CAGTCTCAGCCCCAGGCCGTCGG + Intergenic
1084625021 11:70299797-70299819 TCGTCTCAGAGCCGGGACCTCGG + Intronic
1088517716 11:110656605-110656627 CCCTCTCATCCCCAGGGCCTAGG - Intronic
1089587735 11:119520809-119520831 CTGTCTCTGCCCTGGCACCTGGG - Intergenic
1089610685 11:119666937-119666959 CTGGCTCAGCCGCGTGACCTTGG - Intronic
1090039941 11:123281904-123281926 CAGTCTCAGCCCATGGACTTTGG - Intergenic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1096747554 12:53738650-53738672 CCTTGGCAGCCCGGGGACCTTGG - Intergenic
1096775172 12:53959381-53959403 CCATCTCAGCCCCGGGATTATGG - Intergenic
1102639927 12:114358071-114358093 CCTTCTCAGCCATGTGACCTTGG - Intronic
1102907364 12:116687263-116687285 CCGTCTGAGCCCAGGGTGCTGGG - Intergenic
1103781808 12:123403687-123403709 CACTCTCAGCCACGGGACCAGGG - Intronic
1104439691 12:128784805-128784827 CCATCTCAGCCCTGGGGCATAGG + Intergenic
1104757266 12:131277032-131277054 CTGGCTCAGCCCGGGGACTTGGG + Intergenic
1104847108 12:131852171-131852193 CCGGCCGAGCACCGGGACCTGGG + Intergenic
1104928418 12:132325709-132325731 ACCTCTCAGACCTGGGACCTGGG + Intronic
1113086390 13:106573406-106573428 CCATCTCAGGCCTAGGACCTAGG + Intergenic
1113967502 13:114162428-114162450 CTGTCTCTGCCCCTTGACCTCGG + Intergenic
1115622438 14:35153125-35153147 CCGTCTCAATCCCGGCACCTCGG + Intronic
1118439334 14:65798686-65798708 ACGGCTCAGCCCCGGGTCCCAGG - Intergenic
1120941757 14:89956137-89956159 TCGCCTCGGCCCCGGGGCCTCGG + Intronic
1122246027 14:100404209-100404231 CCCTCTCAGCCCCAGGTCCTTGG - Intronic
1122251866 14:100445611-100445633 CCGTCTCAGCCCTGGCAACAAGG - Intronic
1122284061 14:100640411-100640433 CTGTCTCATCCACCGGACCTGGG + Intergenic
1122974016 14:105163737-105163759 CCTGCTCAGTCCTGGGACCTGGG + Intronic
1123473590 15:20571769-20571791 CGGTCCCAGCCCCAGGGCCTGGG + Intergenic
1123644419 15:22428584-22428606 CGGTCCCAGCCCCAGGGCCTGGG - Intergenic
1123733888 15:23166780-23166802 CGGTCCCAGCCCCAGGGCCTGGG + Intergenic
1123906804 15:24929612-24929634 GGGTCTCAGCCCAGGGCCCTGGG - Intronic
1124368546 15:29090548-29090570 CCCTGTCAGCCCCAGGCCCTGGG - Intronic
1127659079 15:61083197-61083219 CCGTGTCAGCCTCGGGACAACGG - Intronic
1129526220 15:76216783-76216805 CCCTGTCAGCCCTGGGTCCTGGG - Intronic
1129667788 15:77589074-77589096 ACTTCTCAGCCCTGGGACCTGGG - Intergenic
1131272319 15:90954930-90954952 CCACCTCAGTCCCGGGACCGCGG - Exonic
1132298401 15:100761397-100761419 CCTGGTCAGCCCCGGGGCCTGGG + Intergenic
1132999642 16:2842396-2842418 CCGCCTCTGCCCCTGGCCCTGGG - Intergenic
1133036934 16:3038733-3038755 CTGTCCCAGCCCCAGGACCCAGG - Intergenic
1133062547 16:3184010-3184032 CCGTCTGCGTCCCGGGACCCCGG + Intergenic
1133063113 16:3188266-3188288 CCGTCTGCGTCCCGGGACCCCGG - Intergenic
1133209925 16:4257859-4257881 ACACCCCAGCCCCGGGACCTCGG + Exonic
1134455164 16:14390082-14390104 CCCTCTCAGCCCTGTGACCTTGG - Intergenic
1135103425 16:19626389-19626411 CTGTCTTAGCCCTGTGACCTTGG + Intronic
1136024819 16:27462581-27462603 TGGTCTCAGCCCTGTGACCTGGG - Intronic
1138099998 16:54244669-54244691 GCGTGACAGCCCGGGGACCTAGG - Intergenic
1138278171 16:55751342-55751364 CCGACTCAGGCCCTGCACCTGGG + Intergenic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1141063389 16:80895431-80895453 CCGTCTCATCCCCAAGCCCTAGG - Intergenic
1141834287 16:86528492-86528514 CCGTGTCAGCCCTGTCACCTGGG + Intergenic
1144409625 17:14988047-14988069 CTGTCTCAGCCCCTGCCCCTTGG - Intergenic
1147563300 17:41521916-41521938 CTGTCTCAGCCTGGAGACCTGGG - Exonic
1148358812 17:46995238-46995260 CTGTCTAAGCCCCAGGACCTAGG + Intronic
1148588054 17:48794889-48794911 CAGTCACAGCTGCGGGACCTGGG + Intronic
1148748635 17:49932075-49932097 CCTCCTCAGCCCCCGGGCCTGGG - Intergenic
1150286784 17:63959230-63959252 CCATCCCAGCCCCTGGCCCTGGG + Intronic
1150787807 17:68176902-68176924 CTGCCTAAGCCCCAGGACCTAGG - Intergenic
1151121990 17:71802838-71802860 CTGACTCAGCCCCCTGACCTTGG + Intergenic
1151346873 17:73507713-73507735 CCCTCCCAGCCACGGGACCTTGG - Intronic
1153925954 18:9835129-9835151 CCGTCTTAGCTACAGGACCTAGG - Intronic
1153997634 18:10455185-10455207 CCGTCTCAGCCCTGGGAGAGGGG + Intronic
1155209130 18:23586186-23586208 ACGGCTCAGGCCCGGGTCCTGGG - Intronic
1157585864 18:48800757-48800779 CCCACTCAGCCCTTGGACCTGGG - Intronic
1157677010 18:49576578-49576600 CTGTCTCAGCCCCAGTAGCTGGG + Intronic
1157822661 18:50785037-50785059 CCTTCACAGCCCCGGTACCTTGG - Intergenic
1160242397 18:77132906-77132928 CCGGCGCCGCCCCGGGAGCTCGG + Intronic
1160525143 18:79531450-79531472 CCGTCTCCTCCCTGGGACCTCGG + Intergenic
1161324004 19:3654362-3654384 CTGTCTCAGCCCCGACACCTGGG - Intronic
1161496925 19:4591525-4591547 CTGTCTCAGCCCAGGTTCCTTGG - Intergenic
1161501696 19:4619736-4619758 CCGTCTCTGCCTCAGTACCTGGG - Intergenic
1161589644 19:5123534-5123556 CAGTCCTAGCCCCCGGACCTGGG - Intronic
1161735299 19:5988569-5988591 CCAGCTCCTCCCCGGGACCTAGG + Intergenic
1162940724 19:14007227-14007249 CCGACCCAGCCCAGGGAGCTTGG + Intergenic
1163035081 19:14565308-14565330 CCCTCTCTGCCCTGGGACTTGGG + Intronic
1163665723 19:18603418-18603440 CCGCTTCTGCCCCAGGACCTTGG - Intronic
1165912386 19:39237233-39237255 CCGCCTCTTCCCCAGGACCTGGG - Intergenic
1165913570 19:39244434-39244456 CCGCCTCTTCCCCAGGACCTGGG - Exonic
1165917395 19:39269190-39269212 CCGCCTCTTCCCCAGGACCTGGG + Exonic
1166259361 19:41627104-41627126 CCGCCTCTGCCCCTGGCCCTGGG - Intronic
1166289579 19:41853883-41853905 CCTTCTCAGCTCTGTGACCTTGG - Intergenic
1166343965 19:42153973-42153995 CCGTCCCTCCCCCGGCACCTTGG + Intronic
1166599309 19:44080088-44080110 CCTTCCCAGCCACGTGACCTTGG - Intronic
1166700471 19:44879009-44879031 TCTTCCCAGCCCTGGGACCTAGG - Intronic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
1168692526 19:58385713-58385735 CAGGCCCAGCCCTGGGACCTGGG + Intergenic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
928126528 2:28620430-28620452 CTGTCTCAGCGCTGGGACCTGGG - Intronic
929042577 2:37759764-37759786 AAATCTCAGCCCCGTGACCTAGG - Intergenic
932419628 2:71593873-71593895 CCGCCTGAGCCCAGTGACCTGGG - Intronic
935562908 2:104577046-104577068 CCATCTCATCCCCTGGACCTAGG + Intergenic
936152125 2:110027686-110027708 CCATTTCTGCCCCTGGACCTGGG - Intergenic
936192553 2:110343727-110343749 CCATTTCTGCCCCTGGACCTGGG + Intergenic
936972391 2:118187849-118187871 CCCTCTCAGCCCAGGTACATGGG - Intergenic
938792907 2:134692550-134692572 CCCTCCCAGCCCCTGGATCTTGG - Intronic
947156109 2:227164348-227164370 CCGCCTGGGCCCCCGGACCTTGG + Intergenic
947949592 2:234135876-234135898 CCGCCTCGGACCTGGGACCTGGG + Intergenic
948901872 2:240960343-240960365 CCGTGTCAACCTCGGGCCCTTGG - Intronic
949034013 2:241808054-241808076 CCCTCTTAGCCCAGGGACCTCGG + Intergenic
1169120547 20:3093157-3093179 CCGTCTGAGCCCCAGGCCCCAGG + Intergenic
1169171765 20:3471089-3471111 CCGTCTCAGCCCCGGGAAGATGG + Exonic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1175466805 20:59194775-59194797 CTCTCTCAACCCCGGGCCCTGGG - Intronic
1175692775 20:61077500-61077522 ACTTCTCAGCCACGGGACATTGG - Intergenic
1176101116 20:63365029-63365051 GCGTCCCAGCACTGGGACCTGGG - Intronic
1178544248 21:33479925-33479947 CCACCTCAGCCCCGGGAGCCCGG + Exonic
1178680868 21:34670709-34670731 GCGTCCGAGCCCCGGGCCCTGGG + Exonic
1179809900 21:43864385-43864407 CCCTCTCAGCCCCAGGACAGCGG - Intergenic
1179874058 21:44258645-44258667 CCTGGTCGGCCCCGGGACCTCGG - Exonic
1180000746 21:44994216-44994238 CCCTCACAGCCCAGGGCCCTGGG - Intergenic
1183605923 22:38866674-38866696 AGGCCTCAGCCCCGGGCCCTGGG - Exonic
1184160275 22:42693566-42693588 GCCTCTCTGCCCCGGCACCTGGG - Exonic
1184479256 22:44737468-44737490 CCGTCTCTGGCCCGGCCCCTGGG - Exonic
1184784038 22:46663213-46663235 CAGCCTCAGCCCAGGGACCGGGG - Intronic
1185052860 22:48562899-48562921 CTCTCACAGCCCCGGGACCCCGG + Intronic
1185128293 22:49023743-49023765 CCGGCTCAGACCCGGGATCCAGG - Intergenic
1185329177 22:50244463-50244485 CCTTCTCAGCTCCGGGCCCCCGG + Exonic
1185385842 22:50531041-50531063 CCGTATAGGCCGCGGGACCTGGG + Exonic
950590861 3:13935028-13935050 CCGTCTCTGCCTCCGGACCCCGG - Intergenic
952850740 3:37726598-37726620 CTGTCCCAGCCCCGGAAGCTTGG - Intronic
953017258 3:39089240-39089262 CAGTCTCACCCCCGGAATCTCGG - Exonic
956452288 3:69386333-69386355 CCGTCCCTGCCCCGCGCCCTGGG - Intronic
958632412 3:96700730-96700752 CCCTCCCAGCCCGGGCACCTGGG + Intergenic
960950592 3:122996276-122996298 CCGTCTGGGCCCCGGGATCTGGG + Intronic
961191745 3:124968114-124968136 CCATGTCAGCCCCTGCACCTGGG - Exonic
961446477 3:126983743-126983765 CCGTCCCGGCCGCTGGACCTCGG + Intergenic
962247274 3:133806075-133806097 CCCTCTCAGCCCCGCGTCCCCGG - Intronic
967511932 3:190322485-190322507 CCGCCTCAGCCCCGGCAGCCGGG + Intergenic
968453189 4:684613-684635 GCGTCTCAGCCCCGGAGCCCGGG + Intronic
969405117 4:6986614-6986636 CTTGCTCAGCCCTGGGACCTGGG + Intronic
971244148 4:24913128-24913150 CGCCCTCAGCCCCGCGACCTCGG + Intronic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
984961090 4:185099501-185099523 CCGGCTCAGCCCCCAGGCCTGGG - Intergenic
985964260 5:3327854-3327876 GTGTCACAGCCGCGGGACCTGGG - Intergenic
986658778 5:10040785-10040807 CCAGCTCAGCTCAGGGACCTGGG - Intergenic
987345358 5:16974037-16974059 CCACCTCAGCCCCGGTAGCTGGG + Intergenic
989139536 5:38189239-38189261 CCGTCTGACCTCCGGGGCCTGGG + Intergenic
989996208 5:50835425-50835447 CTGCCTCAGCCCCAGGAGCTGGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995760407 5:115556059-115556081 GCAGCTCAGCCCCAGGACCTAGG - Intergenic
999247052 5:150160622-150160644 CCCTCTCAGCCCCAGGACCGTGG + Intergenic
1005905669 6:30260142-30260164 GAGACTCAGACCCGGGACCTGGG - Intergenic
1006500845 6:34457950-34457972 CCCTCTCAGGCACAGGACCTGGG + Intergenic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1013052436 6:106549289-106549311 CCTGGTCAGCCCGGGGACCTTGG + Intronic
1017759442 6:157556708-157556730 CTGTTCCAGCCCCGGGGCCTCGG - Intronic
1023937145 7:44748484-44748506 CCGACCCCGCCCCGGCACCTTGG + Intergenic
1026871547 7:73855828-73855850 CCTTCTCCGCCCCAGGACCCAGG - Intergenic
1027333811 7:77127117-77127139 CCCTCTCACCCACGGGACCCAGG - Intronic
1028193253 7:87876264-87876286 CAGTCTCAGACCCGGGCTCTCGG - Exonic
1029781981 7:102744197-102744219 CCCTCTCACCCACGGGACCCAGG + Intergenic
1033585904 7:142774128-142774150 CCTCCTCAGCCCCGCCACCTTGG - Intergenic
1034885301 7:154794278-154794300 TCGTCTCAGCCCTCGGGCCTGGG + Intronic
1035253694 7:157613140-157613162 CCGCCTCAGCCGCAGAACCTCGG + Intronic
1035851090 8:2919944-2919966 CCTTCTCAGCCCCAGATCCTAGG + Intergenic
1037305303 8:17497523-17497545 CCGGCTCTGCCCGGGGACTTCGG + Intronic
1037581149 8:20246735-20246757 CGGACTCTGCCCCTGGACCTGGG - Exonic
1037737814 8:21581227-21581249 TCGCCTGAACCCCGGGACCTCGG + Intergenic
1038038852 8:23707315-23707337 GCTTCTCAGCCCCAGGACCGAGG + Intergenic
1042553168 8:70012230-70012252 CCCTCACAGCCCCGGAGCCTTGG - Intergenic
1045063915 8:98428860-98428882 CCGCATCAGCCTCAGGACCTGGG - Exonic
1049474157 8:142789158-142789180 CCCACTCAGCCCCTGGAGCTGGG + Intergenic
1049749486 8:144276547-144276569 CCGTGTCAGCCCAGGGACAGAGG - Intronic
1052901619 9:33798695-33798717 CCGCCTCAGCCCTGCCACCTTGG - Intronic
1053479485 9:38405362-38405384 CCATCTCAGCCCTGGGCACTGGG + Intergenic
1053875499 9:42540899-42540921 CCGTCTCAGGCGCAGGACCCTGG + Intergenic
1053897148 9:42753734-42753756 CCGTCTCAGGCGCAGGACCCTGG - Intergenic
1054151765 9:61611504-61611526 CCATCACAAGCCCGGGACCTAGG - Intergenic
1054236201 9:62560825-62560847 CCGTCTCAGGCGCAGGACCCTGG - Intergenic
1056126215 9:83538331-83538353 GCGGCTCAGCCCCGGGACATCGG + Exonic
1056874230 9:90312533-90312555 CTGACTCAGCCCCTTGACCTGGG + Intergenic
1057198706 9:93129231-93129253 GCTTCTGAGCCCCGGGGCCTGGG - Intronic
1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG + Intergenic
1061680949 9:132242155-132242177 CCGGCCCCGCCCCGGGACCCCGG - Exonic
1062000860 9:134215003-134215025 CCCTTGCAGCCCCGTGACCTTGG - Intergenic
1185791269 X:2929353-2929375 CCCTCTCAGCTGCGGGATCTGGG + Intergenic
1187172918 X:16869749-16869771 CCGCCTCCGCCCCGGGGCCGAGG + Exonic
1191025473 X:55908747-55908769 TCCTCCCAGCCCCGGGGCCTGGG - Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG + Intergenic
1201682191 Y:16659090-16659112 CTGTCTCAGCCTCTGGAGCTGGG - Intergenic