ID: 973614740

View in Genome Browser
Species Human (GRCh38)
Location 4:52667095-52667117
Sequence CCACCCTACTTGGCTAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973614740_973614749 21 Left 973614740 4:52667095-52667117 CCTAAGTTAGCCAAGTAGGGTGG No data
Right 973614749 4:52667139-52667161 ACTTGGGAGGCTGTGACGAGAGG No data
973614740_973614744 5 Left 973614740 4:52667095-52667117 CCTAAGTTAGCCAAGTAGGGTGG No data
Right 973614744 4:52667123-52667145 GCCTATAGTCCCATGTACTTGGG 0: 3
1: 78
2: 3763
3: 50577
4: 192673
973614740_973614743 4 Left 973614740 4:52667095-52667117 CCTAAGTTAGCCAAGTAGGGTGG No data
Right 973614743 4:52667122-52667144 CGCCTATAGTCCCATGTACTTGG No data
973614740_973614746 8 Left 973614740 4:52667095-52667117 CCTAAGTTAGCCAAGTAGGGTGG No data
Right 973614746 4:52667126-52667148 TATAGTCCCATGTACTTGGGAGG 0: 5
1: 132
2: 4882
3: 62536
4: 185700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973614740 Original CRISPR CCACCCTACTTGGCTAACTT AGG (reversed) Intergenic
No off target data available for this crispr