ID: 973616719

View in Genome Browser
Species Human (GRCh38)
Location 4:52686180-52686202
Sequence GACAAGGATGTTCCAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973616719_973616728 26 Left 973616719 4:52686180-52686202 CCTTTTGTTGGAACATCCTTGTC No data
Right 973616728 4:52686229-52686251 TCCTCTTTCTCCTGCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973616719 Original CRISPR GACAAGGATGTTCCAACAAA AGG (reversed) Intergenic
No off target data available for this crispr