ID: 973619059

View in Genome Browser
Species Human (GRCh38)
Location 4:52709688-52709710
Sequence ATGGAGGAGGAGACTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973619053_973619059 14 Left 973619053 4:52709651-52709673 CCGCATGGAAGAAGATGAGGAAG No data
Right 973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG No data
973619052_973619059 15 Left 973619052 4:52709650-52709672 CCCGCATGGAAGAAGATGAGGAA No data
Right 973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973619059 Original CRISPR ATGGAGGAGGAGACTGAGAA AGG Intergenic
No off target data available for this crispr