ID: 973621892

View in Genome Browser
Species Human (GRCh38)
Location 4:52735169-52735191
Sequence CTGCTGGTAGAGGTTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973621892_973621896 -9 Left 973621892 4:52735169-52735191 CCATGCCCAACCTCTACCAGCAG 0: 1
1: 0
2: 3
3: 33
4: 391
Right 973621896 4:52735183-52735205 TACCAGCAGTTTCTTTTGTCTGG 0: 1
1: 0
2: 0
3: 24
4: 226
973621892_973621898 27 Left 973621892 4:52735169-52735191 CCATGCCCAACCTCTACCAGCAG 0: 1
1: 0
2: 3
3: 33
4: 391
Right 973621898 4:52735219-52735241 ATCCCCCATCTTTACAAGACAGG 0: 1
1: 0
2: 1
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973621892 Original CRISPR CTGCTGGTAGAGGTTGGGCA TGG (reversed) Intronic
900760308 1:4466092-4466114 CTGGGGGCAGAGGGTGGGCATGG + Intergenic
901164330 1:7206975-7206997 CTGCTGGTAGGAGTTGAGAATGG + Intronic
901311750 1:8274933-8274955 CTGCTGATCAAGGCTGGGCACGG + Intergenic
901807865 1:11749355-11749377 CAGCTGGTTGAGGGTGGGAATGG + Intronic
901991539 1:13118406-13118428 GTGAGGGTAGAGGATGGGCATGG + Intergenic
902124162 1:14194537-14194559 CTGCTGGGAGAGGATGGGTCTGG - Intergenic
902979488 1:20112897-20112919 TTGGTGGGAGAGGTGGGGCAGGG + Exonic
904041465 1:27587486-27587508 TGGCTGGTAGAATTTGGGCAGGG - Intronic
904463572 1:30694662-30694684 CTGGTGGTAGAGACTGGGCCCGG - Intergenic
904798025 1:33072099-33072121 CTGCTGGCACGGGCTGGGCACGG - Intronic
904994332 1:34619208-34619230 CTGCATGGAGAAGTTGGGCAAGG - Intergenic
905470509 1:38188229-38188251 CTGCAGGGAGAGGTTTGGGAAGG + Intergenic
906237337 1:44219922-44219944 CTGTGGATATAGGTTGGGCAGGG + Intronic
906527896 1:46507066-46507088 CTGCTGGTGCAGGTTGTACATGG - Exonic
906645207 1:47469887-47469909 GTGCTGGAACACGTTGGGCAAGG + Intergenic
907444359 1:54498584-54498606 CTGCTGGTCTAGGTGGGGGAGGG - Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
908336308 1:63127689-63127711 CTGCTGGTAGATCTTGGTGATGG + Intergenic
909864803 1:80654085-80654107 TGGCCAGTAGAGGTTGGGCACGG - Intergenic
909978510 1:82071407-82071429 TTGCTGGGACAGGTTGGGGAGGG + Intergenic
910938181 1:92504382-92504404 ATCCTGGTTGAGGTTAGGCAGGG + Intergenic
910966746 1:92815619-92815641 CTACTGGTTGTGGCTGGGCATGG - Intergenic
911706568 1:101020593-101020615 CTGCTGCTAGAGCTTGGGATGGG - Intronic
913964944 1:143368970-143368992 CAGATGGTAGAAGCTGGGCATGG - Intergenic
914059318 1:144194572-144194594 CAGATGGTAGAAGCTGGGCATGG - Intergenic
914119832 1:144771799-144771821 CAGATGGTAGAAGCTGGGCATGG + Intergenic
914808917 1:151012258-151012280 CAGCTGGTGGAGGATGGGCTTGG + Intronic
915299776 1:154945316-154945338 ATGCAGGTAGAGGTAGGGCAGGG + Intronic
915641466 1:157230387-157230409 GTGCTGGTAGAGGAAGGCCAAGG + Intergenic
915931341 1:160062462-160062484 CTGCTGGTAGAGGGTGAGGGGGG + Intronic
916718227 1:167462626-167462648 CTGCTGGGAGAGGTGTGCCAGGG + Intronic
917502838 1:175601227-175601249 CAGCGGGTAGAGTTTGGGTAAGG + Intronic
919612347 1:199760635-199760657 TTGTTTGTAGAGGCTGGGCATGG - Intergenic
919712647 1:200743648-200743670 CTGCTAATATAGGCTGGGCATGG + Intronic
919902233 1:202052610-202052632 AAGCTGGTAGGGGCTGGGCATGG + Intergenic
920039361 1:203085617-203085639 CCGCTGGTTGGGGTTGAGCAGGG + Exonic
922168989 1:223139411-223139433 ATGCTGTTAGAGGCTGTGCAGGG + Intronic
922360169 1:224813960-224813982 CTGTTGGTAGGGGTTGGGGGAGG - Intergenic
922414240 1:225405930-225405952 CTTATACTAGAGGTTGGGCAGGG - Intronic
922753300 1:228081249-228081271 CTGCTGGCAGAGCGTGGCCAGGG - Intergenic
922987474 1:229877143-229877165 CTGGTAGTAGAGGCCGGGCACGG + Intergenic
1062958191 10:1553975-1553997 CGGCTGGTGGAGGCTGTGCAGGG + Intronic
1063193430 10:3718734-3718756 TTGTTGGTAAAGGTTGGACAAGG - Intergenic
1064150027 10:12855087-12855109 GTTCTGGCAGAGGTTGGGGATGG + Intergenic
1064539072 10:16387862-16387884 GTGTTGGTAGAGATTGGGCCAGG - Intergenic
1064557765 10:16564691-16564713 ATGCTTGGAGAGGTTGGGGATGG + Intergenic
1066070840 10:31809449-31809471 CTTCTGGTAGATGCTTGGCAGGG + Intronic
1066984464 10:42453102-42453124 CTGCTGGGAGAGGCGGGGGATGG - Intergenic
1067337821 10:45378973-45378995 CTGCAGGTGTAGGTAGGGCAGGG + Intronic
1067370886 10:45680592-45680614 CTGCTGGCAGAGGCAGGGGATGG + Intergenic
1067385808 10:45817169-45817191 CAGCTGGCTGAGGTCGGGCATGG - Intronic
1067388891 10:45845553-45845575 CTGCTGGCAGAGGCAGGGGATGG - Intronic
1067417171 10:46111395-46111417 CTGCTGGCAGAGGCAGGGGATGG + Intergenic
1067502586 10:46818289-46818311 CTGCTGGCAGAGGCAGGGGATGG + Intergenic
1067689297 10:48491127-48491149 CTGCTGGGGGATGTTGAGCAGGG - Intronic
1067730988 10:48811473-48811495 CTGCTGGTCAAGGTGGGGCCTGG - Intronic
1068746143 10:60532856-60532878 CTGCTGGGAAATGTTGGGCAGGG + Intronic
1068971627 10:62964075-62964097 CTGCTGACAGAGCTTGGCCAAGG - Intergenic
1069574719 10:69518339-69518361 GTGTTGGTAGAGGGAGGGCATGG - Intergenic
1069689546 10:70340845-70340867 CTCCTGGAAGAGGGAGGGCAGGG - Intronic
1070118927 10:73556877-73556899 GTGCTGGTAGAGGGTGGGTGGGG - Intronic
1070136110 10:73695962-73695984 CTGCTGGCAGAGGCAGGGGATGG - Intronic
1070148535 10:73791802-73791824 CTACTGGGAAAGGATGGGCATGG - Intronic
1070753323 10:78976620-78976642 CTGCTGGCAGACCTTGGACAGGG - Intergenic
1070988226 10:80707087-80707109 TAGCTAGCAGAGGTTGGGCACGG - Intergenic
1071257395 10:83883824-83883846 CTGCTGTTGGAGGTGGGGCCTGG + Intergenic
1071609864 10:87022380-87022402 CAGCTGGCTGAGGTCGGGCAGGG + Intronic
1071962532 10:90821274-90821296 CTGCTGCTGGGGGTTGGGGAAGG - Intronic
1073491174 10:103854673-103854695 CGGAGGGTGGAGGTTGGGCAAGG + Intronic
1075135599 10:119782735-119782757 CAGCTGGCAGAGGTGGGGCCTGG + Intronic
1075152306 10:119944938-119944960 CTCCTGGAAGAGGCTGGGGAGGG + Intergenic
1075290079 10:121221876-121221898 CTGCTACCAGAGGGTGGGCAGGG + Intergenic
1075473814 10:122715716-122715738 CTCCTCCTAGAGGTTGGGGAGGG + Intergenic
1076875536 10:133213884-133213906 CTGCTGGTGCAGGGTGGGCTGGG - Intronic
1077104740 11:837284-837306 CTGGTGGTAGCGCTTGGTCATGG - Exonic
1077231338 11:1459378-1459400 CTCCTGGTAGAGGATGGGGCCGG - Intronic
1077368571 11:2171213-2171235 CTGCTGCTAGAGCCTGGGAAGGG + Intronic
1078291894 11:10020031-10020053 TTCCTGGTTGGGGTTGGGCAGGG - Intronic
1078710932 11:13790260-13790282 CAGCTGGAAGAGAGTGGGCATGG - Intergenic
1081968849 11:47185294-47185316 CTTCTGGAAGAGGTTGGGGCTGG - Intronic
1083550970 11:63590029-63590051 CTGCTGACGGAGGCTGGGCATGG - Intronic
1083765598 11:64840059-64840081 CAGCTGGCAGGGGTTGGGCAGGG + Intronic
1084270280 11:68025845-68025867 GTGATGGTACAGGTGGGGCAGGG - Intronic
1084351474 11:68603057-68603079 CTGCTGGGAGAAGCTGGGTATGG + Intronic
1084891578 11:72239548-72239570 CTGCTGGTAGAGGGTGGGTGAGG + Exonic
1085746944 11:79123098-79123120 CTGCTGGGAAACGTTGGGAAAGG + Intronic
1086901005 11:92367303-92367325 CTGGTAGTAGAGGCTGGGCATGG + Intronic
1088011144 11:105002302-105002324 CTTCTGATAGAGGTTAGGGAAGG - Intronic
1091375553 12:22660-22682 TTGGGGGAAGAGGTTGGGCAGGG + Intergenic
1091820183 12:3470407-3470429 CGGATGGTAGGGGCTGGGCAGGG + Intronic
1091909703 12:4219599-4219621 CTGGAGGTAGGGGCTGGGCATGG - Intergenic
1092101174 12:5884900-5884922 CTGATGGTGGTGGGTGGGCAGGG - Intronic
1092370983 12:7916368-7916390 CAGATGGTTGAGGTTGGGCTAGG - Intergenic
1092840417 12:12535171-12535193 CTGGTGGAGGAGGATGGGCAGGG - Intronic
1093710235 12:22321423-22321445 CTGCTGCTTCAGTTTGGGCAGGG - Intronic
1095405210 12:41860463-41860485 CCCCTGCTGGAGGTTGGGCAGGG + Intergenic
1095450685 12:42327389-42327411 CTGCATTTAAAGGTTGGGCATGG + Intronic
1096497267 12:52045798-52045820 CTCATGGTAGGGCTTGGGCAAGG + Intronic
1097168617 12:57099489-57099511 CTTATGGTAGGGGTTGGGGAAGG - Intronic
1100268129 12:92998120-92998142 CTTCTGGTAGAGATTGGTCTTGG + Intergenic
1100443137 12:94635991-94636013 CTGAGGGGAGAGGTTGGGAAGGG + Intronic
1100457314 12:94765084-94765106 GTGGTGTCAGAGGTTGGGCAAGG - Intergenic
1100822835 12:98447668-98447690 AGGCTGGGAGAGGTTGGGAAGGG - Intergenic
1101260022 12:103019482-103019504 CTATTGGTAGGGGCTGGGCACGG + Intergenic
1102011034 12:109618507-109618529 CTACTGGCTGAGGCTGGGCAGGG - Intergenic
1102183722 12:110932043-110932065 CTGCTCGTAGAGTTTGAGGATGG + Intergenic
1102566476 12:113800590-113800612 CTGCTGGTTTTGGCTGGGCACGG + Intergenic
1102570372 12:113823674-113823696 CTGCGGGTAGAAGATGGGGAGGG - Intronic
1102765790 12:115431890-115431912 GGGCCGGTAGAGGTTGGGCAGGG - Intergenic
1103721126 12:122976161-122976183 CTGCTGTAAAAGCTTGGGCAAGG - Intronic
1103995743 12:124828913-124828935 CTGCTGGTCCAGAGTGGGCAGGG - Intronic
1104416146 12:128598124-128598146 CTGTTGGAGGAGGCTGGGCACGG + Intronic
1104750310 12:131234233-131234255 CAGGTGGTACAGATTGGGCATGG + Intergenic
1107290062 13:38841943-38841965 GTGATGGTAGAAGTTGAGCAAGG + Intronic
1112693384 13:101919644-101919666 CTGCTGGGAGAGGTAGGGCTGGG - Intronic
1113034726 13:106036884-106036906 CTGCTGGGAGAGCCTGGGAAGGG - Intergenic
1113749632 13:112768244-112768266 CTGCTGGTAGAGGTGGAGGCGGG - Intronic
1113984724 13:114304387-114304409 CTGCTGGTACATGCTAGGCAGGG + Intronic
1114494569 14:23123740-23123762 CTGCTGGCAGATGTAGGGCAAGG - Intergenic
1115153349 14:30310872-30310894 ATTCTGGAAGAGGTAGGGCATGG - Intergenic
1118249329 14:64143615-64143637 CTCCTGGTGTAGGTTGGGGAGGG + Intronic
1118284865 14:64462073-64462095 ATACTGGTAGGGGCTGGGCATGG + Intronic
1119037445 14:71242289-71242311 CTGCAGGGAGAGGCTGGACAAGG - Intergenic
1119384330 14:74247896-74247918 CTGCTGGTCGAGGGAGGGCGAGG - Intronic
1119973612 14:79000695-79000717 CTGCTGGTGGAGGTTGCGGGAGG + Intronic
1120398733 14:84001517-84001539 CTGCTGGCAGAGGCAGGACAAGG + Intergenic
1120784490 14:88519970-88519992 CTTCTGGTAGAGGTAGTCCAGGG - Intronic
1120951496 14:90046032-90046054 CTGCTGTCAGGGGTTGGGCCTGG - Intergenic
1120988955 14:90358147-90358169 CTGCCTGTACAGGCTGGGCATGG - Intergenic
1121047064 14:90796073-90796095 CTGATGGTATAGTTTGTGCATGG - Intronic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1124138681 15:27057857-27057879 CTTCTGGTAGTGGATGTGCATGG - Intronic
1124207515 15:27734400-27734422 GTGCTGATTGAGGTTGGGAAAGG - Intergenic
1124431680 15:29613874-29613896 CTGCTGGGTGAGTTTGGGCATGG - Intergenic
1124780981 15:32633348-32633370 TTCCTGTTAGAGGCTGGGCACGG + Intronic
1124801709 15:32839218-32839240 CTGCTGGGAGTGGGTGGGCAGGG - Intronic
1124949713 15:34306049-34306071 ATGCTGGAGGAGGCTGGGCACGG - Intronic
1128612352 15:69084267-69084289 CTGCTGGGAGTGGAAGGGCAAGG - Intergenic
1128763708 15:70237574-70237596 CTGGTGGCAGTGGTTGGGGATGG + Intergenic
1129100687 15:73259909-73259931 CACCTGGTAGAGTTTGGGAATGG + Intronic
1129467831 15:75733777-75733799 CTGCTGGGTGACTTTGGGCAAGG + Intergenic
1129885167 15:79032270-79032292 CTCTTGGTAGATGTTGAGCATGG + Exonic
1130061816 15:80575808-80575830 CTGCTGGGTGAGGGTGGCCAGGG + Intronic
1130297434 15:82657056-82657078 CTGCTGGTGAAGGCTGGGCTGGG - Intergenic
1131214221 15:90523705-90523727 ATAATGGTAGAGGCTGGGCACGG + Intergenic
1131822190 15:96284619-96284641 CTGCTGGTTGATGTTGGCCATGG - Intergenic
1132221170 15:100106655-100106677 ATGCTGGCAGAGGCTGGGGATGG + Intronic
1132381547 15:101369874-101369896 CTGCTGGTGCAGGTTCTGCAGGG + Intronic
1132827737 16:1913486-1913508 GTGCAGGGTGAGGTTGGGCAGGG + Intronic
1132906227 16:2284126-2284148 CTGCTGTGGGAGGTGGGGCAAGG + Intronic
1133586612 16:7201792-7201814 AGGCTGGTAGAGAATGGGCACGG + Intronic
1134132900 16:11661740-11661762 CTACGGGTACAGGCTGGGCATGG - Intergenic
1134629366 16:15745875-15745897 CAGCTGGTGTAGGCTGGGCATGG - Intronic
1134913956 16:18053567-18053589 CTGTTGGAGGAGGTTGTGCATGG - Intergenic
1135268931 16:21052318-21052340 CTGCAGGTTGGGGGTGGGCAAGG - Intronic
1135389678 16:22080072-22080094 CAGCTAGTAGAGGCTGGGCATGG - Intronic
1135602195 16:23792946-23792968 CAGCTGGTTGGGGCTGGGCATGG - Intergenic
1136024359 16:27460456-27460478 CTGCTGGCTGAGGCTGGGCGGGG + Intronic
1138694990 16:58804735-58804757 CTGGTGGTAGAGGCTGGGCACGG - Intergenic
1139812948 16:69637928-69637950 CTTCTGGTAGAGGCTGGGCACGG + Intronic
1141420956 16:83915260-83915282 CTGCAGGTGGAAGTTGGCCACGG - Exonic
1142200748 16:88760076-88760098 CTGCTTGTGGAGGGTGGGCCAGG - Intronic
1142414758 16:89935305-89935327 CTGCTGGGTGAGCTCGGGCACGG - Exonic
1143394415 17:6580790-6580812 CAGCTGTTAGAGGTGGGGCTAGG - Intronic
1144180191 17:12744464-12744486 CTGTGGGCAGAGGTTGGGAAGGG + Intronic
1144892425 17:18501563-18501585 CAGCTGGTACAGTTTGCGCATGG - Intergenic
1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG + Intergenic
1145810521 17:27761272-27761294 CAGCTGGTACAGTTTGCGCATGG - Intronic
1146007725 17:29171602-29171624 CAGCTTGATGAGGTTGGGCAAGG + Intronic
1146074218 17:29713043-29713065 CTGCCAGTTGAGGCTGGGCATGG + Intronic
1146230710 17:31105862-31105884 CTGCTGGTGGGGGTGGGACACGG - Intronic
1146283461 17:31559548-31559570 CTGCTGCGAGAGGTCGGCCACGG + Intergenic
1146564022 17:33896517-33896539 CTGATGGAGGAGGATGGGCAGGG + Intronic
1146820746 17:35982193-35982215 CTGCTGGTCATGGTTGGCCATGG - Intergenic
1146842517 17:36165800-36165822 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1146854829 17:36253759-36253781 GTGCTGGGAGGGGCTGGGCATGG + Intronic
1146865791 17:36334617-36334639 GTGCTGGGAGGGGCTGGGCATGG - Exonic
1146870729 17:36377651-36377673 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1146878087 17:36428732-36428754 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1147068661 17:37935229-37935251 GTGCTGGGAGGGGCTGGGCATGG - Exonic
1147073612 17:37978275-37978297 GTGCTGGGAGGGGCTGGGCATGG + Intergenic
1147085134 17:38057813-38057835 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1147096132 17:38138726-38138748 GTGCTGGGAGGGGCTGGGCATGG - Intergenic
1147101080 17:38181779-38181801 GTGCTGGGAGGGGCTGGGCATGG + Intergenic
1147372136 17:39999740-39999762 GTGCTGCTCCAGGTTGGGCACGG + Intergenic
1147654588 17:42081664-42081686 CTCTGGGTAGAGGTTGGGCGTGG - Intergenic
1147835493 17:43328029-43328051 CTGCTGAGAGAGGTCGGGGAAGG + Intergenic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1148755606 17:49971572-49971594 CTGCTGGGAGAGTTGGGGCGCGG + Intronic
1149013283 17:51880152-51880174 CTGCTGGAAGAGGTAAGGCAAGG - Intronic
1149977235 17:61278463-61278485 CAGTTGATAGAGGCTGGGCATGG - Intronic
1151784164 17:76266791-76266813 CTGCTGGGGGAGGAGGGGCAGGG + Intronic
1153320964 18:3773997-3774019 CTGCTGGGAGATGTTGGGGAAGG - Intronic
1154204507 18:12325643-12325665 CTGCTGGGTGAGCTCGGGCACGG - Exonic
1155521077 18:26669719-26669741 ATGCTGGTCTAGGTTGGGCATGG + Intergenic
1157673728 18:49552349-49552371 CTTTTGGGAGAGGTTGTGCATGG - Intergenic
1158135642 18:54204856-54204878 TTGCTGGGACAGGGTGGGCAGGG + Intronic
1160782708 19:884916-884938 CTGCTGGAAGATGTTGTTCACGG + Exonic
1161391268 19:4022036-4022058 CTGCAGGTCCAGATTGGGCATGG - Intronic
1162463737 19:10829013-10829035 CTGCGGGCAGGGGTTGGGGAGGG - Intronic
1162795078 19:13082808-13082830 CTGCTGCGAGAGGTCAGGCAGGG + Intronic
1163118384 19:15201093-15201115 GTGCGGGTGGAGGGTGGGCAGGG - Intergenic
1163384549 19:16991481-16991503 CACCTGGTAGGGGATGGGCAGGG + Intronic
1163545051 19:17936387-17936409 CTGCGGGAAGAGGATGGGGATGG - Intronic
1163658900 19:18564801-18564823 CTTCTGGGCCAGGTTGGGCAGGG + Intronic
1165895022 19:39136300-39136322 CTGCTGGGAGAGGTGGAGCCAGG - Intronic
1167557693 19:50206042-50206064 CTGCTGGTTGAGGAAGGGTAGGG + Intronic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168276447 19:55281057-55281079 CTGCTGGGCGTGGTTGTGCAGGG + Intergenic
1202698721 1_KI270712v1_random:146459-146481 CAGATGGTAGAAGCTGGGCATGG - Intergenic
928852041 2:35759668-35759690 CTGCTGCCAGGGGTTGGGGAGGG + Intergenic
929941370 2:46336435-46336457 CTGCTGGAAGAAGTAGGGCTTGG + Intronic
930223729 2:48770903-48770925 TAGCTGGTGGAGGATGGGCAAGG + Intronic
930586910 2:53277920-53277942 CTGATGTTAGAGGTGGGGCCTGG - Intergenic
932049128 2:68381453-68381475 CTCCTGACAGAGGTTGGGAATGG + Intronic
932485872 2:72083994-72084016 GTGATGGTAGAGGTGGTGCAGGG + Intergenic
934279968 2:91604244-91604266 CAGATGGTAGAAGCTGGGCATGG - Intergenic
934522673 2:95029846-95029868 CTGCTGGTAGGGGCCGGGGAAGG - Intronic
936024705 2:109022222-109022244 CTGCAGTTAGGGGTTGGGCTGGG + Intergenic
937933679 2:127225354-127225376 CTGCTGGTCACGGTGGGGCAGGG + Intergenic
939171617 2:138702516-138702538 CTTCTGATAGTGGTTGGGTAGGG - Intronic
940402618 2:153265125-153265147 GTGCTGTTTGAGGTTGGGGAAGG + Intergenic
941412778 2:165180512-165180534 ATGGTGGTAGTGGTTGGGAAAGG + Intronic
942303122 2:174581502-174581524 CGGCTGGGAAAGGTTGGGTACGG + Intronic
943802302 2:192076665-192076687 GTGCTAGTAGAGGGTGGGCAAGG - Intronic
944027302 2:195186649-195186671 AGTCTGGTAGAGGATGGGCATGG - Intergenic
944529469 2:200653067-200653089 CAGCTGGTAGAGGTAAGGCTGGG + Intronic
945941389 2:215954550-215954572 CTGCTGTTTGCGGTTGGGCATGG - Intronic
946892832 2:224296148-224296170 CTGTAGGTAGAGGATGGGGATGG - Intergenic
947227239 2:227852447-227852469 CTCCTGCAAGAGGTTGAGCATGG - Intergenic
947610799 2:231524025-231524047 GTGCTGGGAGAGGCTGGGGAGGG + Exonic
948430366 2:237914701-237914723 CTGCTGGTTGTGGTTGTGGAGGG + Intergenic
948535572 2:238643976-238643998 CCACTGGTAGAGGTAGTGCAGGG + Intergenic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
1168919409 20:1518528-1518550 GTGCTGGGAGAGGTTGGGGGTGG + Intergenic
1168980579 20:2000151-2000173 ATGCTGGTATAGGCTGGGCATGG - Intergenic
1169111585 20:3037481-3037503 CTGTTGCCAGAGGTTGGGCCAGG + Intronic
1169733339 20:8810671-8810693 CGTCTGGTAGAGGCCGGGCATGG + Intronic
1170592332 20:17780275-17780297 CTGATGTTGGAGGTTGGGCCTGG + Intergenic
1170652764 20:18257675-18257697 CTGCAGGGTAAGGTTGGGCAGGG + Intergenic
1170940562 20:20844998-20845020 TTGCTGGTATATTTTGGGCAGGG - Intergenic
1172261331 20:33568495-33568517 CTGCTGGAAGAGCTGGGGGATGG + Intronic
1172273900 20:33669583-33669605 CTGATGGGACAGGTTGGGCTGGG - Intronic
1173188610 20:40859775-40859797 CTGCTGGTAGTGGTGGGGAGGGG - Intergenic
1173850242 20:46213228-46213250 CTGCTGGCAGAGGCTGGGGAAGG - Intronic
1174793116 20:53498526-53498548 CTCCTGGCAGTGGTCGGGCAGGG - Intergenic
1175288061 20:57851062-57851084 ATGCTGGTAGAGTTGGGGCATGG + Intergenic
1177030116 21:15972407-15972429 CTGCTGGCAGGGGTTGGGCAGGG - Intergenic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1179283399 21:39954122-39954144 AAGCTGAAAGAGGTTGGGCATGG - Intergenic
1179432754 21:41335351-41335373 CTGTTGTTGGAGGTGGGGCATGG + Intronic
1181052068 22:20242647-20242669 CTGCAGGTAGAGGTACTGCAGGG + Exonic
1181489313 22:23251714-23251736 CTGCTGGTAACCTTTGGGCAGGG + Intronic
1182786877 22:32915389-32915411 CTGGTGCCAGAGGTTGGGTAAGG + Intronic
1182861326 22:33561840-33561862 CTTCTGGTAGAGGCTGAGGATGG + Intronic
1183320165 22:37160401-37160423 CTTCTGGGAGGGTTTGGGCAGGG + Intronic
1183895549 22:40965730-40965752 GTGCGGGTAGGGGCTGGGCACGG - Intronic
1184403925 22:44289382-44289404 TTCCTGGTAGAGGGTGGGCCGGG - Intronic
1184947914 22:47817330-47817352 CTTCTGGTAGAGGTGGGGAGAGG + Intergenic
1185315410 22:50176835-50176857 CTCCTGGGAGGGGTTCGGCAGGG + Intronic
949173385 3:1030067-1030089 CTGTTGGGAGATGTGGGGCACGG - Intergenic
949295542 3:2518009-2518031 CTGCAGGGAGAGGTAGGGGAGGG - Intronic
949928023 3:9057538-9057560 CTGCTGGGAGGGGAGGGGCAAGG - Intronic
950486854 3:13278907-13278929 CAGATGGGAGAGCTTGGGCAAGG + Intergenic
950693277 3:14677858-14677880 CTGCTGCTAGGGGTTAGCCAAGG - Intronic
951728381 3:25783761-25783783 CTGGTCGTACAGGTTGGGAAGGG + Intronic
952745344 3:36771674-36771696 CTGGTGGTGGTGGTGGGGCAGGG - Intergenic
952918040 3:38264333-38264355 CTGGTGGGAGAGGTTGGGGTGGG + Intergenic
953179171 3:40580680-40580702 CTAGTGGCAGATGTTGGGCATGG - Intergenic
954191147 3:48962412-48962434 CTGCTGGTAGAGGTGGTGGGTGG - Intronic
954521744 3:51233657-51233679 CTGCTGAAAGAGGATGGGCGTGG - Intronic
954710167 3:52501615-52501637 CTGGGGGCAGAGGGTGGGCAGGG - Intronic
955033491 3:55243221-55243243 CGGCTGGTAGAGATTAGGAATGG + Intergenic
957761632 3:84566369-84566391 CTCATAGTAGAGGTTGGGAAAGG - Intergenic
958634774 3:96729818-96729840 CTGCTGCCATAGGGTGGGCACGG + Intergenic
961139970 3:124547595-124547617 CTCTGGGTACAGGTTGGGCATGG - Intronic
963884864 3:150570770-150570792 CTGCTGACAGAGGCTGGGCACGG + Intronic
963925184 3:150943910-150943932 CTCCTGCAAGAGGTTGAGCAGGG + Intronic
964630629 3:158805986-158806008 CTTCTGTTAGAGGCTGAGCAGGG + Intronic
969761963 4:9193024-9193046 CTACTGCCCGAGGTTGGGCAAGG - Intergenic
969938229 4:10704581-10704603 CTGCTCCTCTAGGTTGGGCAGGG + Intergenic
970391759 4:15619041-15619063 CTACTTGTAGTGGTGGGGCAGGG + Intronic
973247598 4:48026001-48026023 CTGCTGTGAGAGGATGGTCAAGG - Intronic
973621892 4:52735169-52735191 CTGCTGGTAGAGGTTGGGCATGG - Intronic
975479140 4:74858360-74858382 TGGCTGGTGGAGGCTGGGCATGG - Intergenic
978810089 4:112840097-112840119 CTGCTGTTAGAGGAAGGACAAGG - Intronic
980338142 4:131501962-131501984 ATACTGGAAGAGGTCGGGCACGG + Intergenic
980731166 4:136825705-136825727 CTGGTGGTAAAGGCTGAGCATGG + Intergenic
981904259 4:149903105-149903127 ATGCTAGGAGAGGCTGGGCACGG + Intergenic
983798767 4:171901180-171901202 CTGGAGGTAGAGGGTGGGCAGGG - Intronic
983800641 4:171925145-171925167 CTCCTGGTAAAGGGTGAGCAGGG + Intronic
985177600 4:187218509-187218531 CTGCTGGGAGACGTAGGGAATGG + Intergenic
985494145 5:195133-195155 CTGCTGGTTGAACTTGGACATGG - Exonic
985665299 5:1178963-1178985 CTGCTGGCTGAGGCTGGGCTTGG + Intergenic
985962286 5:3311708-3311730 CTGACGGTAGAGGTTGGTAAGGG - Intergenic
986491477 5:8295745-8295767 ATGGTGGTAGAGGCTGGGCGTGG + Intergenic
986707552 5:10464072-10464094 CGGCTGGGACAGGTGGGGCAGGG - Intronic
988280086 5:29134253-29134275 CTGCTGGAACAGGGAGGGCAAGG + Intergenic
989199253 5:38747342-38747364 CTGCTGCTTGAGGCTGGGCTAGG - Intergenic
989210898 5:38857956-38857978 TAGCTGGAAGAGGCTGGGCATGG - Intronic
991267982 5:64745298-64745320 CTGATGATACAGGCTGGGCATGG + Intronic
991955928 5:71996082-71996104 CAGCTGGAAGACTTTGGGCAAGG - Intergenic
992190647 5:74288158-74288180 CTCCTTGTAGAGGTGGGGCAGGG - Intergenic
992454347 5:76902476-76902498 CTGCTGCCAGGGGTGGGGCAGGG + Intronic
994003235 5:94806037-94806059 GTTCTGGTAGAGGTTTGGTATGG + Intronic
994659895 5:102641293-102641315 CTGCTGCTGGGGGTTGGGGAAGG - Intergenic
994733655 5:103524796-103524818 CCGCTGGGAGAGGTAGGACAGGG + Intergenic
996064102 5:119062903-119062925 AAGTAGGTAGAGGTTGGGCATGG + Intronic
996595806 5:125201464-125201486 CTGCTGGGAAAAGATGGGCAAGG + Intergenic
997912287 5:137888209-137888231 CTGCTGGGAGAGGTTGAGCTGGG + Intronic
999261834 5:150243179-150243201 GCCCTGGTAGAGGCTGGGCAAGG - Intronic
999266542 5:150270442-150270464 TTGCTAGAAGAGGCTGGGCAGGG + Intronic
999480678 5:151945430-151945452 CTGCTGGGAGATCTTGGGCTAGG - Intergenic
999842144 5:155439401-155439423 CTGCTGGAAGAGGCAGGGGAAGG - Intergenic
999920346 5:156311651-156311673 CTGCTGGTAGAGGAGGGTAATGG - Intronic
1000109997 5:158099211-158099233 GTGGTGGTTGAGCTTGGGCATGG + Intergenic
1000159981 5:158587616-158587638 CTGCTGCTGGGGGTTGGGGAGGG + Intergenic
1001009792 5:168087071-168087093 CTGCTGCTATAACTTGGGCAAGG - Intronic
1001031761 5:168268517-168268539 ATGCTTGTGGAGGCTGGGCACGG - Intergenic
1001120009 5:168972225-168972247 GTGCAGGATGAGGTTGGGCAGGG + Intronic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1002501167 5:179648606-179648628 CGGCTGGATGAGGTGGGGCAGGG - Intergenic
1003620570 6:7695832-7695854 TAGCTGGTAGGAGTTGGGCAAGG + Intergenic
1003840061 6:10111048-10111070 CTGCTGGGTGAGTTTGGCCAAGG + Intronic
1003888275 6:10540541-10540563 CTGGTGGTTGGGGGTGGGCAGGG - Intronic
1004209882 6:13628867-13628889 CTGCTGGTAAAAGTTGGTAAAGG + Intronic
1004596755 6:17106215-17106237 ATGGTGGCAGAGGTTGGGGATGG - Intronic
1005135864 6:22569673-22569695 CACCTGGTAGCGGTTGGGCTGGG - Exonic
1005579920 6:27224021-27224043 ATGCTGATTGAGGCTGGGCATGG + Intergenic
1007093988 6:39202242-39202264 ATGCTGGAAGTGGTTGGGGATGG - Intronic
1007176954 6:39903561-39903583 TTGATGGTAGAGGTTAGGCAGGG - Exonic
1008147345 6:47907753-47907775 CTGCTGGCAAAGGTTGAGCAGGG + Intronic
1008704744 6:54144306-54144328 CTTCTGGAAGAAGTTGGACATGG + Intronic
1012783137 6:103589118-103589140 CTGCTGCTAGAGATTGGGGAAGG + Intergenic
1013024230 6:106253880-106253902 CTGCATGTAGAGTTTGGTCAGGG - Intronic
1013731378 6:113172097-113172119 CTGCAGGTAAAGGTCTGGCAGGG - Intergenic
1016325230 6:142893178-142893200 TTGCTGGGTGACGTTGGGCAAGG + Intronic
1017097599 6:150818502-150818524 GTGGTGGTAGAGGTTGGGGCAGG - Intronic
1017981000 6:159401250-159401272 CTCCTGGCAGAGGATGGGGAGGG - Intergenic
1018428429 6:163703926-163703948 CTGGTGGTGGAGGTGGAGCAAGG - Intergenic
1018475706 6:164138867-164138889 ATGCTGGTGAAGGCTGGGCATGG + Intergenic
1018746747 6:166768210-166768232 GTTCTGGTTGAGGTTGGGTATGG + Intronic
1019621146 7:1992673-1992695 CTGCTGGGGGAGCTTGGGGAAGG + Intronic
1019971282 7:4542919-4542941 CTGGTGGTTGAGGCTGTGCATGG + Intergenic
1020082483 7:5294229-5294251 CTTCTGGTCAAGGCTGGGCATGG - Intronic
1020809875 7:12838708-12838730 CTGCTAGTAAAGTTTGGGTAGGG + Intergenic
1020973363 7:14976004-14976026 CTGCTGTTGGAGGTGGGGCCTGG - Intergenic
1022028982 7:26474847-26474869 CTGCTGGTGGATGGAGGGCATGG - Intergenic
1023333665 7:39146214-39146236 CTGCTTTTGGAGGGTGGGCATGG + Intronic
1023625224 7:42108885-42108907 CTGCTGGTGGAGGGTGGGATGGG - Intronic
1023862517 7:44224959-44224981 CTCCTGGGAGGGGCTGGGCAGGG - Intronic
1024533302 7:50410446-50410468 CTGTGGGTAGAGGGTGGGCTGGG + Intergenic
1024631361 7:51250141-51250163 CAGCTGGTGGAGGTTTGTCAAGG - Intronic
1025196446 7:56937945-56937967 CTTCTGGTCAAGGCTGGGCATGG + Intergenic
1025198452 7:56948736-56948758 CGGCTGGGAGAGGTGGGGCCTGG - Intergenic
1025675501 7:63638991-63639013 CTTCTGGTCAAGGCTGGGCATGG - Intergenic
1026207832 7:68273600-68273622 CTGCTAGGCGAGGCTGGGCACGG - Intergenic
1027202706 7:76073419-76073441 CTGCAGGTGGGGGTTGGGCCTGG + Intergenic
1029170734 7:98627573-98627595 CTGTGGTTAGAGGTTGGGCGTGG + Intronic
1029415110 7:100437502-100437524 CTTTTGGTAGAGATTGGGAATGG - Intergenic
1029424718 7:100488523-100488545 CTGCCGGAAGAGGCTGGGGAAGG + Exonic
1029853481 7:103489302-103489324 CTGCTGGAAGAGGCTGAGGAAGG + Intronic
1031564299 7:123276226-123276248 CTGCTGTTAAAGGTAAGGCATGG + Intergenic
1032373699 7:131386996-131387018 CTGCTAGTACAGGATGGACAAGG + Intronic
1032403576 7:131640156-131640178 TTGCTGGTGGAGGCTGGGCATGG + Intergenic
1032650118 7:133868965-133868987 CTGCTGGGAGAGGCAGGGCAGGG - Intronic
1033598872 7:142875067-142875089 CTGCTGGTAGAGGTGAGGTGTGG - Exonic
1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG + Intergenic
1035057327 7:156044214-156044236 CTGCAGGTTTAGGCTGGGCATGG + Intergenic
1036272066 8:7314890-7314912 CTACTGCCCGAGGTTGGGCAAGG - Intergenic
1036349279 8:7995455-7995477 CTACTGCCCGAGGTTGGGCAAGG + Intergenic
1036844570 8:12155992-12156014 CTACTGCCCGAGGTTGGGCAAGG + Intergenic
1036865940 8:12398325-12398347 CTACTGCCCGAGGTTGGGCAAGG + Intergenic
1040013245 8:42679826-42679848 CTGTTGTTTGAGGCTGGGCACGG - Intergenic
1041408338 8:57526539-57526561 TGGCTGGTGGAGGCTGGGCACGG + Intergenic
1041547456 8:59061829-59061851 CTCCTGGCAGGGGCTGGGCATGG - Intronic
1041721600 8:60981014-60981036 CAGCTGGAAGAGGCTGGGGATGG + Intergenic
1044205224 8:89485735-89485757 CTGCTGCTGGTGGTTTGGCAAGG - Intergenic
1047029175 8:120857894-120857916 CTGCTGGTACAGGCTGGGCCTGG - Intergenic
1047636505 8:126768789-126768811 CGGGTGGTAGAGGCTGGGGAGGG + Intergenic
1048261585 8:132949855-132949877 CTGCTGGGAGAGGCAGTGCAGGG - Intronic
1049095825 8:140547518-140547540 CTTCAGGCAGAGGTTGGACAGGG + Exonic
1049442808 8:142616984-142617006 CTGCTGGAGGGGGTTGGGGAGGG - Intergenic
1049706506 8:144045612-144045634 CTGCAGGAGGAGCTTGGGCAGGG + Intronic
1051992027 9:23163041-23163063 GTGCTGCTTGAGGTTGGGGAGGG - Intergenic
1053146121 9:35713213-35713235 CTACTGGGAGAGGTTGCCCAGGG - Exonic
1055494189 9:76838352-76838374 ATGCAGGCAGAGGCTGGGCATGG + Intronic
1055788283 9:79894761-79894783 GAGCTGGTGGAGGCTGGGCATGG + Intergenic
1055807739 9:80116127-80116149 CTGCTGGCTGGGGTTGGGGAGGG - Intergenic
1055814526 9:80188925-80188947 CTGATGCTAGAGGTGGGGCCTGG - Intergenic
1056330425 9:85516799-85516821 ATGCTGGTAGAGGGTGAGGATGG - Intergenic
1057232712 9:93334450-93334472 CTGATCGAAGAGGCTGGGCACGG - Intronic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1058561383 9:106232683-106232705 CTGTTGGTAGAGACTGGGCTTGG + Intergenic
1058694920 9:107551072-107551094 TTGCAGGTAGAGGCCGGGCACGG + Intergenic
1058836576 9:108862965-108862987 CTGGTGGTGGAGGTGGGCCATGG + Exonic
1059311784 9:113393392-113393414 CTGCTGGTTGGGGTTGGGGTTGG - Intronic
1059473981 9:114529109-114529131 CTGCTGATAGAGGTTCGACAAGG + Intergenic
1061049327 9:128185316-128185338 GTACTGGTAGTGTTTGGGCATGG + Intronic
1061147096 9:128806383-128806405 CTGCTGCGACAGGCTGGGCAGGG + Intronic
1061399378 9:130360041-130360063 CTTCTGGTAGGGGGAGGGCAGGG + Intronic
1061904054 9:133687569-133687591 GTGCTGGTAGAGGCTGGGCTCGG - Intronic
1062193251 9:135258487-135258509 CAGCTGGTGGAGGTGGGGCAGGG - Intergenic
1062252603 9:135605759-135605781 CTGATGGCATAGGCTGGGCATGG + Intergenic
1062422482 9:136489830-136489852 CTGCTGGTGCACGCTGGGCATGG - Intergenic
1062584514 9:137243072-137243094 CTGCTGGGTGAGCTCGGGCACGG - Exonic
1203779537 EBV:93435-93457 CTGGTGGGAGAGGTTGTGCGTGG - Intergenic
1185467681 X:364271-364293 CTGCTGGTACGAGCTGGGCAGGG + Intronic
1185593244 X:1292259-1292281 GTCCAGGTAGAGGTGGGGCAGGG - Intronic
1185593566 X:1294083-1294105 GTCCAGGTAGAGGTGGGGCAGGG - Intronic
1186669873 X:11757974-11757996 CTGCCGGTAGACCTTGGCCAGGG + Intergenic
1188040699 X:25367287-25367309 CTGCTGCCAGAGGTCGGGGAGGG + Intergenic
1189145483 X:38650908-38650930 GAGATGGGAGAGGTTGGGCAGGG - Intronic
1189331055 X:40145437-40145459 CGGATGGTAGAGGTGGGGGAGGG - Intronic
1190552473 X:51598914-51598936 TTGCTGTGAGAGGCTGGGCACGG - Intergenic
1191867934 X:65720646-65720668 CTCCTGGTAGAGCCTGGGCCTGG + Intronic
1193555908 X:82953219-82953241 CTGGTGGTAGTGGTTGTGGACGG - Intergenic
1194390719 X:93314704-93314726 CTGTTGGTAGGTGGTGGGCAAGG - Intergenic
1194514538 X:94835624-94835646 CTGGTGGTGGGGGTTGGGAATGG - Intergenic
1194899347 X:99489499-99489521 TGGCTGCTAGAGGTTGGGAAGGG - Intergenic
1195203151 X:102568516-102568538 CTTCTGGGAGAGGGTAGGCAAGG - Intergenic
1196682900 X:118486864-118486886 CTGATGAAAGAGTTTGGGCAAGG - Intergenic
1196700386 X:118661485-118661507 TTCCTGTTAGAGGTTGGGGAAGG - Intronic
1196742679 X:119039284-119039306 CTGATGAAAGAGTTTGGGCAAGG - Intergenic
1197996265 X:132378166-132378188 CTGATGTTAAAGTTTGGGCAGGG + Exonic
1198428267 X:136541215-136541237 CTGCTGAGGGAAGTTGGGCATGG + Intronic
1199834247 X:151573045-151573067 CTGGGGGTAGAGGTTGGGGGTGG + Intronic
1202138551 Y:21696341-21696363 CTGGTGGAAGAGCTTGGGCTTGG - Intergenic