ID: 973624475

View in Genome Browser
Species Human (GRCh38)
Location 4:52757646-52757668
Sequence TCACTCTTCCCCAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973624470_973624475 -8 Left 973624470 4:52757631-52757653 CCTCGGCTCCTTCTCTCACTCTT No data
Right 973624475 4:52757646-52757668 TCACTCTTCCCCAGGGAAGGAGG No data
973624469_973624475 1 Left 973624469 4:52757622-52757644 CCTGGCTTGCCTCGGCTCCTTCT No data
Right 973624475 4:52757646-52757668 TCACTCTTCCCCAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973624475 Original CRISPR TCACTCTTCCCCAGGGAAGG AGG Intergenic
No off target data available for this crispr