ID: 973625503

View in Genome Browser
Species Human (GRCh38)
Location 4:52768201-52768223
Sequence CACATTGTGCACGTGTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973625503_973625504 13 Left 973625503 4:52768201-52768223 CCAGGGTACACGTGCACAATGTG No data
Right 973625504 4:52768237-52768259 TATGTATACATGTGCCATGTTGG 0: 10076
1: 16018
2: 8885
3: 6827
4: 5856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973625503 Original CRISPR CACATTGTGCACGTGTACCC TGG (reversed) Intergenic
No off target data available for this crispr