ID: 973626713

View in Genome Browser
Species Human (GRCh38)
Location 4:52779821-52779843
Sequence AATATGCAACAGAATTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973626710_973626713 -2 Left 973626710 4:52779800-52779822 CCTAGTTGTGGTCCCTAGGATAA No data
Right 973626713 4:52779821-52779843 AATATGCAACAGAATTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973626713 Original CRISPR AATATGCAACAGAATTACCC TGG Intergenic
No off target data available for this crispr