ID: 973633326

View in Genome Browser
Species Human (GRCh38)
Location 4:52839646-52839668
Sequence GGATGGATAGAAATTGAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973633326_973633330 20 Left 973633326 4:52839646-52839668 CCGGTTTCAATTTCTATCCATCC No data
Right 973633330 4:52839689-52839711 ATCATTTGATTTCTCCTCCTTGG No data
973633326_973633327 -10 Left 973633326 4:52839646-52839668 CCGGTTTCAATTTCTATCCATCC No data
Right 973633327 4:52839659-52839681 CTATCCATCCATTAGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973633326 Original CRISPR GGATGGATAGAAATTGAAAC CGG (reversed) Intergenic