ID: 973633326 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:52839646-52839668 |
Sequence | GGATGGATAGAAATTGAAAC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
973633326_973633330 | 20 | Left | 973633326 | 4:52839646-52839668 | CCGGTTTCAATTTCTATCCATCC | No data | ||
Right | 973633330 | 4:52839689-52839711 | ATCATTTGATTTCTCCTCCTTGG | 0: 1 1: 0 2: 0 3: 26 4: 321 |
||||
973633326_973633327 | -10 | Left | 973633326 | 4:52839646-52839668 | CCGGTTTCAATTTCTATCCATCC | No data | ||
Right | 973633327 | 4:52839659-52839681 | CTATCCATCCATTAGAGATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
973633326 | Original CRISPR | GGATGGATAGAAATTGAAAC CGG (reversed) | Intergenic | ||