ID: 973633328 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:52839663-52839685 |
| Sequence | TTCTCCAGATCTCTAATGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973633328_973633330 | 3 | Left | 973633328 | 4:52839663-52839685 | CCATCCATTAGAGATCTGGAGAA | No data | ||
| Right | 973633330 | 4:52839689-52839711 | ATCATTTGATTTCTCCTCCTTGG | No data | ||||
| 973633328_973633333 | 26 | Left | 973633328 | 4:52839663-52839685 | CCATCCATTAGAGATCTGGAGAA | No data | ||
| Right | 973633333 | 4:52839712-52839734 | TATGCTACCCATATCTAACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973633328 | Original CRISPR | TTCTCCAGATCTCTAATGGA TGG (reversed) | Intergenic | ||