ID: 973633328

View in Genome Browser
Species Human (GRCh38)
Location 4:52839663-52839685
Sequence TTCTCCAGATCTCTAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973633328_973633330 3 Left 973633328 4:52839663-52839685 CCATCCATTAGAGATCTGGAGAA No data
Right 973633330 4:52839689-52839711 ATCATTTGATTTCTCCTCCTTGG No data
973633328_973633333 26 Left 973633328 4:52839663-52839685 CCATCCATTAGAGATCTGGAGAA No data
Right 973633333 4:52839712-52839734 TATGCTACCCATATCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973633328 Original CRISPR TTCTCCAGATCTCTAATGGA TGG (reversed) Intergenic