ID: 973633329

View in Genome Browser
Species Human (GRCh38)
Location 4:52839667-52839689
Sequence TAGCTTCTCCAGATCTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973633329_973633333 22 Left 973633329 4:52839667-52839689 CCATTAGAGATCTGGAGAAGCTA No data
Right 973633333 4:52839712-52839734 TATGCTACCCATATCTAACAAGG No data
973633329_973633330 -1 Left 973633329 4:52839667-52839689 CCATTAGAGATCTGGAGAAGCTA No data
Right 973633330 4:52839689-52839711 ATCATTTGATTTCTCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973633329 Original CRISPR TAGCTTCTCCAGATCTCTAA TGG (reversed) Intergenic