ID: 973633330

View in Genome Browser
Species Human (GRCh38)
Location 4:52839689-52839711
Sequence ATCATTTGATTTCTCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973633328_973633330 3 Left 973633328 4:52839663-52839685 CCATCCATTAGAGATCTGGAGAA No data
Right 973633330 4:52839689-52839711 ATCATTTGATTTCTCCTCCTTGG No data
973633329_973633330 -1 Left 973633329 4:52839667-52839689 CCATTAGAGATCTGGAGAAGCTA No data
Right 973633330 4:52839689-52839711 ATCATTTGATTTCTCCTCCTTGG No data
973633326_973633330 20 Left 973633326 4:52839646-52839668 CCGGTTTCAATTTCTATCCATCC No data
Right 973633330 4:52839689-52839711 ATCATTTGATTTCTCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973633330 Original CRISPR ATCATTTGATTTCTCCTCCT TGG Intergenic