ID: 973635877

View in Genome Browser
Species Human (GRCh38)
Location 4:52861965-52861987
Sequence GCGCGCGTGGGCTGTGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973635864_973635877 18 Left 973635864 4:52861924-52861946 CCCGCCCAGAGCAGACGCCCTAG No data
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635868_973635877 13 Left 973635868 4:52861929-52861951 CCAGAGCAGACGCCCTAGGTTGG No data
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635863_973635877 22 Left 973635863 4:52861920-52861942 CCGGCCCGCCCAGAGCAGACGCC 0: 1
1: 0
2: 0
3: 27
4: 199
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635861_973635877 28 Left 973635861 4:52861914-52861936 CCGCTCCCGGCCCGCCCAGAGCA No data
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635873_973635877 0 Left 973635873 4:52861942-52861964 CCTAGGTTGGGGCTGCAGCGAGT No data
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635865_973635877 17 Left 973635865 4:52861925-52861947 CCGCCCAGAGCAGACGCCCTAGG No data
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635872_973635877 1 Left 973635872 4:52861941-52861963 CCCTAGGTTGGGGCTGCAGCGAG No data
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635867_973635877 14 Left 973635867 4:52861928-52861950 CCCAGAGCAGACGCCCTAGGTTG No data
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data
973635862_973635877 23 Left 973635862 4:52861919-52861941 CCCGGCCCGCCCAGAGCAGACGC 0: 1
1: 0
2: 1
3: 11
4: 254
Right 973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973635877 Original CRISPR GCGCGCGTGGGCTGTGGAGC CGG Intergenic
No off target data available for this crispr